ID: 1017923420

View in Genome Browser
Species Human (GRCh38)
Location 6:158890486-158890508
Sequence GAGGATGCACTGTGGGACCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 169}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017923417_1017923420 -10 Left 1017923417 6:158890473-158890495 CCTGCACATGTCGGAGGATGCAC 0: 1
1: 0
2: 0
3: 4
4: 52
Right 1017923420 6:158890486-158890508 GAGGATGCACTGTGGGACCGTGG 0: 1
1: 0
2: 2
3: 15
4: 169
1017923414_1017923420 0 Left 1017923414 6:158890463-158890485 CCAGATGGCACCTGCACATGTCG 0: 1
1: 0
2: 1
3: 11
4: 81
Right 1017923420 6:158890486-158890508 GAGGATGCACTGTGGGACCGTGG 0: 1
1: 0
2: 2
3: 15
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017923420 Original CRISPR GAGGATGCACTGTGGGACCG TGG Intronic
900294624 1:1942745-1942767 GAGGCTTCACTGTGGGAACAGGG - Intronic
900724562 1:4207539-4207561 GAGGAGGGACTGTGGCACTGAGG - Intergenic
903230933 1:21921954-21921976 GAGGATGGACTCTGGGACTTAGG + Intronic
904043145 1:27595582-27595604 GAGGATGCACTGTGGTTTTGGGG + Intronic
904541891 1:31239185-31239207 GGGGATGCGCTGTGGGACGGTGG - Intronic
904806431 1:33135569-33135591 GAGGATCCAATGTGAGACCAAGG - Intergenic
905343168 1:37293142-37293164 GAGGATGTAATGTGGGGCCCTGG - Intergenic
905617726 1:39413193-39413215 GAGCATGCACTGTGGTAGCTGGG - Exonic
906224032 1:44106266-44106288 GAGGATGGACAGAGGGACAGAGG - Intergenic
907438440 1:54463979-54464001 GAGTGTGAGCTGTGGGACCGAGG - Intergenic
909388749 1:75092453-75092475 GAGGTTTCACTGTGGGGCGGCGG + Intergenic
917142061 1:171845157-171845179 GAGGATGCAATATGGCACAGAGG - Intronic
1065137735 10:22689136-22689158 GAGGAAGGACAGTGGGACCAGGG - Intronic
1066439071 10:35420571-35420593 GAGAGTGCACTGTGGGATCTAGG + Intronic
1070238695 10:74656264-74656286 GAGGAAGCCCTGTGGGCCCTGGG - Intronic
1075226584 10:120634828-120634850 GAGGATGCAGGGAAGGACCGAGG - Intergenic
1075881288 10:125853850-125853872 GAGGATGAACTATGTGACCTGGG - Intronic
1076335401 10:129703469-129703491 GAGGGTACACTGTGGGAGAGGGG - Intronic
1080598911 11:33802965-33802987 GAGGAGGCAGTGTGGGGCTGGGG - Intergenic
1082742923 11:56930846-56930868 GAGGAAGCACTCTGGGATTGTGG - Intergenic
1082768156 11:57184780-57184802 CAGGATGCAGGGTGGGAACGTGG - Intronic
1083430737 11:62612617-62612639 GAGGGGGCGCTGTGGGCCCGGGG + Exonic
1084471954 11:69367500-69367522 GTGGATGGACTGTGGGCTCGAGG - Intronic
1084705074 11:70811366-70811388 GAGGATGCACAGTGGGGCCGTGG - Intronic
1085058028 11:73419281-73419303 CAAGCTGCACTGTGGGACCAAGG - Intronic
1085457035 11:76670986-76671008 GAGGAAGCGCCGTGGGAGCGAGG + Intergenic
1085535083 11:77212742-77212764 GAGGATGGCCTGGGGGACCCAGG + Intronic
1086844334 11:91730180-91730202 GAGGAAGCACAGTGGGAGTGAGG + Intergenic
1088790207 11:113218331-113218353 GAGAGAGCACTGTGGCACCGTGG - Intronic
1090356153 11:126141612-126141634 GAGGAGCCACAGTGGCACCGAGG + Intergenic
1107467494 13:40664640-40664662 GAGGCTGCCCTGAGGGGCCGGGG - Intronic
1113399704 13:109979555-109979577 CAGGATGCACTGTGGGTCCTGGG + Intergenic
1114736679 14:25049866-25049888 CAGGCTGCACGGTAGGACCGGGG - Exonic
1118278496 14:64407636-64407658 GAGGATCCCCTGGGGGACAGGGG - Intronic
1118760256 14:68876678-68876700 GAAGAGGGACTGTGGGACCCAGG - Intronic
1121535153 14:94686106-94686128 GATGATGCACTGAGAGACCCAGG + Intergenic
1124188884 15:27554230-27554252 GAGGATGCACTGTGGTCTCAGGG - Intergenic
1130918258 15:88323000-88323022 AAGGATGCAGTGCGGGTCCGTGG + Intergenic
1132127527 15:99241443-99241465 GAGGATGGTTTGTGGGACCTGGG - Exonic
1140665134 16:77220638-77220660 GAGGAAGCACAGTGTGACGGAGG - Intergenic
1141860763 16:86714549-86714571 GTGGATGCACTGTGGGGCCCTGG + Intergenic
1142416646 16:89946882-89946904 GAGGATGTACTGTGGGGCCCAGG + Intergenic
1144679625 17:17184330-17184352 GCGGAGGCACTGTAGGAGCGAGG + Intronic
1144738728 17:17569354-17569376 CAGGGTGCACTGTGGGAGAGAGG + Intronic
1152759299 17:82099618-82099640 GTTGACGCACGGTGGGACCGAGG + Intergenic
1203166354 17_GL000205v2_random:100369-100391 GAGGATGCACTCTGAGAGCCCGG - Intergenic
1153067517 18:1062996-1063018 CAGGATCTACTGTGGGACCAAGG + Intergenic
1160987022 19:1843730-1843752 GAGGATGAAAAGTCGGACCGAGG + Intronic
1161283306 19:3456987-3457009 GGTGATGCACTGTGTGACCCTGG - Intronic
1161466847 19:4435809-4435831 GAGGATGCAAGCTGGGGCCGGGG - Intronic
1163588533 19:18177185-18177207 GAGTGTGCAATGGGGGACCGCGG + Exonic
1166068042 19:40371564-40371586 GAGGGGGTACTGTGGGACAGGGG + Intronic
1167337481 19:48895930-48895952 TAGGATGCAGTTTGGGACCTGGG - Intronic
925876705 2:8317394-8317416 GAGGAGCCACTGTAGGACCGGGG + Intergenic
927825981 2:26310713-26310735 GAAGATGTAATGAGGGACCGTGG + Exonic
928327956 2:30334999-30335021 CAGGTGGCACTGTGGGACCCAGG - Intergenic
929283471 2:40109034-40109056 AAGAATGCACTGGGGGACGGGGG - Intronic
931175249 2:59847868-59847890 GAGGAGGGATTGTGGGACCTGGG + Intergenic
932424649 2:71621309-71621331 GAGGAGGCACTGTTGTACTGGGG + Intronic
932486302 2:72086201-72086223 GAGGATGGACAGTGGGGCCCTGG - Intergenic
932734141 2:74242545-74242567 GAGTATGAACTGTGTGACCTTGG - Intronic
933722845 2:85409373-85409395 GAGGACACACTGGGGGACCTCGG + Intronic
937079362 2:119129326-119129348 AAGGATGCACTGTTGGATCTAGG - Intergenic
937823919 2:126344016-126344038 GAGGAGGCACTGAGGGCCAGTGG - Intergenic
938116829 2:128608039-128608061 GGGGATGCGCTGTGGGGGCGGGG + Intergenic
939326978 2:140704708-140704730 AAGGAGGCACTGTGAGACCAGGG + Intronic
939616323 2:144365331-144365353 GAGGATGCATTGTGAGAAAGAGG - Intergenic
940467333 2:154047884-154047906 GAGGAGGCAGTGTGCTACCGGGG - Intronic
945428070 2:209732197-209732219 GAGGATGTACTGAGGCAACGGGG + Exonic
945754467 2:213829641-213829663 TAGTATGCACTGTGGGACTTGGG - Intronic
946466213 2:219914251-219914273 GAGGATGCGCTGTGGGAAAGTGG + Intergenic
948870700 2:240796482-240796504 CAGGATGCACTGTGGGAGATTGG - Intronic
1168892711 20:1305367-1305389 GGGGGTGGACTGTGGCACCGAGG + Exonic
1170089384 20:12573830-12573852 GAAGATGCCCTGTGGGACTGAGG + Intergenic
1170894685 20:20402742-20402764 GAGGGTGCACTGTGGGGATGGGG - Intronic
1171973907 20:31581685-31581707 GAGGATGGACTGAGAGTCCGAGG - Intergenic
1172356773 20:34285672-34285694 GAGGGTGGGCTGTGGGAGCGGGG - Intronic
1174187615 20:48717837-48717859 GAGGATGTGCTGTGTGACCTTGG + Intronic
1174461844 20:50688865-50688887 CAGGATGAACTGGGGGACCCTGG + Intronic
1174929060 20:54793775-54793797 GTGGCTGCACTGTGGGCCCAGGG + Intergenic
1176405401 21:6358727-6358749 GAGGATGCACTCTGAGAGCCCGG + Intergenic
1176431756 21:6630376-6630398 GAGGATGCACTCTGAGAGCCCGG - Intergenic
1176666389 21:9691243-9691265 GAGGATGCACACTGGAAACGTGG - Intergenic
1177533716 21:22397312-22397334 GAGGATGCTCTGTGGATCCTGGG + Intergenic
1179515951 21:41907061-41907083 GGTGATGCCCTGTGGGACTGTGG - Exonic
1180702504 22:17789315-17789337 GAGGGTGCAAGGTGGGACCCTGG - Exonic
1181699873 22:24614774-24614796 AGGGATGCACTGCGGGACGGTGG + Exonic
1182508154 22:30800288-30800310 GAGGCTGCCATGTGGGACCAAGG + Intronic
1184177608 22:42797885-42797907 GAGGATGCTCAGTGGGCCAGAGG + Intronic
1184305743 22:43600385-43600407 GAGCATGCCCTGTGGGCCAGCGG + Intronic
1184680137 22:46067793-46067815 GAGGCTGGACTGTGGGCCAGGGG + Intronic
1185254153 22:49822898-49822920 GAGCCTGCAGTGTGGGACCCTGG - Intronic
953066520 3:39477142-39477164 GAGGAGACACTGTGAGACCTTGG - Intronic
953253113 3:41264333-41264355 GAGGAGGCACTGTGTCAGCGTGG - Intronic
954430728 3:50469701-50469723 GGGCAGGCACTGTGGGACCCGGG - Intronic
955074252 3:55598345-55598367 GAGGAATCACTGTGTGACCTTGG + Intronic
957789028 3:84916768-84916790 TAGGATTCACAGTGGGACTGAGG - Intergenic
958695787 3:97526298-97526320 GAGGATCCACTGTGGAACAGAGG + Intronic
959208369 3:103342734-103342756 GAAGATGCGCTGTAGGACCTTGG + Intergenic
961474277 3:127136968-127136990 GAGGATGAGCTGGGGGACAGAGG - Intergenic
962391772 3:134978274-134978296 GAAGATGCACTGAGGGGCCAGGG - Intronic
965822273 3:172696663-172696685 GAGCATGGACTTTGGGATCGAGG - Intronic
967133469 3:186493903-186493925 GGAGATGTACTGGGGGACCGGGG - Intergenic
967810573 3:193757269-193757291 GGGGATGGACTGTGGGTCTGTGG - Intergenic
968088216 3:195883941-195883963 AAGGATGCACTGAGTGACAGCGG + Intronic
968554927 4:1242061-1242083 CAGGATGCACTGAGGGTCGGAGG - Intronic
968572923 4:1351882-1351904 GAGGATGAACTGCTGGACCACGG - Intronic
972012342 4:34200731-34200753 GTGGTGGCACTGTGGGCCCGAGG + Intergenic
982309161 4:153965989-153966011 GAGGATGCAGTGTGGCGCCAGGG + Intergenic
985408631 4:189661095-189661117 GAGGATGCACGCTGTGAACGTGG + Intergenic
991040393 5:62169247-62169269 GAGGTGGCACTGTGGGGCTGAGG - Intergenic
991403296 5:66276731-66276753 GAGAGTGCTCTGTGGGACTGTGG - Intergenic
992789369 5:80199830-80199852 GATGATCCACTGTGGTACTGTGG - Intronic
995094320 5:108217173-108217195 GAGTATCCACTGTGGGGCTGGGG - Intronic
996332450 5:122345534-122345556 GCTGATGCACTGTGAGACTGGGG - Intronic
997474120 5:134132957-134132979 GAGGAGCCCCTGTGGGACAGTGG + Intronic
1000918887 5:167115440-167115462 GATGAGGCCCTGAGGGACCGTGG - Intergenic
1002565856 5:180112850-180112872 AAGGATGGACGGAGGGACCGAGG + Intronic
1002565864 5:180112869-180112891 GAGGATGGACGGAGGGACCGGGG + Intronic
1002565870 5:180112888-180112910 GGGGATGGACGGAGGGACCGTGG + Intronic
1002565892 5:180112945-180112967 GGGGATGGACGGAGGGACCGGGG + Intronic
1002565900 5:180112964-180112986 GGGGATGGACGGAGGGACCGGGG + Intronic
1002565923 5:180113021-180113043 GGGGATGGACGGAGGGACCGGGG + Intronic
1002565952 5:180113097-180113119 GGGGATGGACGGAGGGACCGGGG + Intronic
1002565984 5:180113192-180113214 CAGGATGGACAGAGGGACCGGGG + Intronic
1002565997 5:180113230-180113252 GGGGATGGACGGAGGGACCGAGG + Intronic
1002566003 5:180113249-180113271 GAGGATGGACGGAGGGACCGAGG + Intronic
1002566017 5:180113287-180113309 CAGGATGGACGGAGGGACCGGGG + Intronic
1002566025 5:180113306-180113328 GGGGATGGACGGAGGGACCGGGG + Intronic
1002566033 5:180113325-180113347 GGGGATGGACGGAGGGACCGGGG + Intronic
1002566055 5:180113382-180113404 GGGGATGGACGGAGGGACCGGGG + Intronic
1002566091 5:180113477-180113499 GGGGATGGACGGAGGGACCGGGG + Intronic
1002566106 5:180113515-180113537 GGGGATGGACGGAGGGACCGGGG + Intronic
1002566157 5:180113649-180113671 GGGGATGGACGGAGGGACCGGGG + Intronic
1002566194 5:180113744-180113766 GGGGATGGACGGAGGGACCGGGG + Intronic
1002566213 5:180113801-180113823 GAGGATGGATGGAGGGACCGAGG + Intronic
1002566219 5:180113820-180113842 GAGGATGGATGGAGGGACCGAGG + Intronic
1002985962 6:2191015-2191037 GAGGCAGCACTGGGGGACCCAGG + Intronic
1003458041 6:6301945-6301967 GAGGAATCACTGTTGGACAGAGG - Intronic
1004303256 6:14477244-14477266 GAGGAGGAAATGTGGGAGCGGGG + Intergenic
1004427045 6:15513656-15513678 AAGGACGCACTGCAGGACCGAGG - Intronic
1006647372 6:35523950-35523972 GGGGATTCACTGTGTGACTGTGG - Intergenic
1007565595 6:42847934-42847956 GAGGTTTCACTGTGTGAGCGAGG - Intronic
1007786528 6:44283266-44283288 GAGGATGCAGTGAGGGGCTGAGG - Intronic
1007896698 6:45369463-45369485 AGGGATTCACTGTGGGACAGAGG - Intronic
1013181687 6:107721740-107721762 GAGAAAGCACTGTGGCACCTGGG - Intronic
1017923420 6:158890486-158890508 GAGGATGCACTGTGGGACCGTGG + Intronic
1019321201 7:416113-416135 GAGGAGGCACTGGGGCCCCGAGG + Intergenic
1022633019 7:32103382-32103404 GAGGATGGACTGGAGGACAGAGG + Intronic
1023992108 7:45134520-45134542 GAGGAAGGTATGTGGGACCGGGG + Intergenic
1026587548 7:71668698-71668720 CAGGATGCACTGGGGGGCCTGGG - Intronic
1029664606 7:101987037-101987059 GAGGAAGCACGGTGGGACAGGGG - Intronic
1030092211 7:105867568-105867590 GAGGGTTCCCTGGGGGACCGAGG + Intronic
1031120674 7:117718152-117718174 GAGTATGCACAGTGTGACTGTGG - Intronic
1031123020 7:117742686-117742708 GACGATGGACTGTGGGACGAGGG + Intronic
1033600652 7:142886095-142886117 GAAGAGGCACTGTGGGAAAGTGG - Intergenic
1034193696 7:149229854-149229876 GAGGACGCAATGTGGGACAAGGG + Intergenic
1034270936 7:149803154-149803176 GAGGGAGCACTGTGGGCACGGGG + Intergenic
1034939300 7:155220160-155220182 CATGATGCAGTGTGGGACGGTGG + Intergenic
1035105720 7:156440371-156440393 GAGGATGCACTGTGAGCCAGGGG - Intergenic
1035277152 7:157754440-157754462 GAGGAGGCGGTGTGGGACCGTGG + Intronic
1035721757 8:1798062-1798084 GAGGTTTGCCTGTGGGACCGGGG + Intergenic
1037414456 8:18634548-18634570 CAGAATGCACTGTGGGATCATGG - Intronic
1045494790 8:102699274-102699296 GAGGAAGCACTGAGGGAGCCTGG + Intergenic
1048573013 8:135670389-135670411 GGGGAAGCACAGTGGGACAGTGG - Intergenic
1049564535 8:143331397-143331419 GAGGAGCCACTGTGGGAGCGGGG - Intronic
1055777523 9:79782333-79782355 GGGGATGCAGTGTGGGCCTGAGG - Intergenic
1056825471 9:89873664-89873686 GAGGGTGGACTGTGGGCCCAGGG + Intergenic
1059443510 9:114324111-114324133 GAGGGTTCACTGTGGGAACAGGG + Intronic
1060225009 9:121785190-121785212 GCAGATGCTCTGGGGGACCGGGG - Exonic
1060786336 9:126454271-126454293 GTGGAGGCACGGTGGGACCCTGG - Intronic
1203439783 Un_GL000195v1:178332-178354 GAGGATGCACTCTGAGAGCCCGG + Intergenic
1203659712 Un_KI270753v1:30518-30540 GAGGATGCACACTGGAAACGTGG + Intergenic
1185467454 X:363224-363246 GGAGATGCACTGTGGGATCGCGG - Intronic
1185467468 X:363282-363304 GGAGATGCACTGCGGGATCGTGG - Intronic
1185467475 X:363311-363333 GGAGATGCACTGTGGGATGGTGG - Intronic
1185467489 X:363369-363391 GGAGATGCACTGTGGGATGGTGG - Intronic
1185467497 X:363398-363420 GGAGATGCACTGTGGGATTGCGG - Intronic
1185467504 X:363427-363449 GGAGATGCATTGTGGGATCGCGG - Intronic
1185467526 X:363514-363536 GGAGATGCACTGCGGGATCGCGG - Intronic
1185467533 X:363543-363565 GGAGATGCACTGCGGGATCGCGG - Intronic
1185467537 X:363572-363594 GGAGATGCATTGTGGGATCGTGG - Intronic
1185467566 X:363687-363709 GAAGATGCACTGTGGGATCGCGG - Intronic
1190281668 X:48935096-48935118 GAGGAGGAACTGGGGGACCAGGG + Intronic
1192560593 X:72125565-72125587 CAGGAAGCACTGTGGGAATGGGG - Intergenic
1195328663 X:103778665-103778687 GAGGATGCACATTGGGTCCCAGG + Intronic
1197046932 X:122008865-122008887 GAGAATGCACTGTTTGACTGAGG - Intergenic