ID: 1017925556

View in Genome Browser
Species Human (GRCh38)
Location 6:158909090-158909112
Sequence GATCGAGACCAGGCCAGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 466
Summary {0: 1, 1: 0, 2: 8, 3: 25, 4: 432}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017925545_1017925556 30 Left 1017925545 6:158909037-158909059 CCTGTACTCCCAGCACTTTGGGA 0: 790
1: 290306
2: 263214
3: 154464
4: 179276
Right 1017925556 6:158909090-158909112 GATCGAGACCAGGCCAGGTGTGG 0: 1
1: 0
2: 8
3: 25
4: 432
1017925549_1017925556 21 Left 1017925549 6:158909046-158909068 CCAGCACTTTGGGAGGCCGAGGT 0: 34548
1: 173488
2: 252592
3: 176597
4: 112373
Right 1017925556 6:158909090-158909112 GATCGAGACCAGGCCAGGTGTGG 0: 1
1: 0
2: 8
3: 25
4: 432
1017925547_1017925556 22 Left 1017925547 6:158909045-158909067 CCCAGCACTTTGGGAGGCCGAGG 0: 120847
1: 270445
2: 211583
3: 123288
4: 170743
Right 1017925556 6:158909090-158909112 GATCGAGACCAGGCCAGGTGTGG 0: 1
1: 0
2: 8
3: 25
4: 432
1017925553_1017925556 5 Left 1017925553 6:158909062-158909084 CCGAGGTGGGCAGATTGTGAGGT 0: 5
1: 104
2: 1967
3: 10141
4: 27830
Right 1017925556 6:158909090-158909112 GATCGAGACCAGGCCAGGTGTGG 0: 1
1: 0
2: 8
3: 25
4: 432

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017925556 Original CRISPR GATCGAGACCAGGCCAGGTG TGG Intronic
900090727 1:919303-919325 GCTGGAGCCCAGGCCAGCTGGGG - Intergenic
900434112 1:2619365-2619387 AATCAAAACTAGGCCAGGTGTGG + Intronic
901594161 1:10371652-10371674 AATAAAGACAAGGCCAGGTGAGG + Intronic
901733820 1:11299405-11299427 GAACCAGTCCAGGCCATGTGTGG - Intergenic
901862455 1:12083396-12083418 TATCGAGAGCAGGCCCGGAGTGG + Intronic
903127288 1:21256682-21256704 GACAGGGACCAGCCCAGGTGGGG - Intronic
903150114 1:21401538-21401560 GGTTGAGACCAGGCCGGGCGTGG + Intergenic
904024440 1:27493425-27493447 GATGAACCCCAGGCCAGGTGTGG - Intergenic
904173453 1:28608461-28608483 GAAAGAGAGCAGGCCGGGTGTGG + Intronic
904381961 1:30117488-30117510 GATGGAGACCGGGTCAGCTGAGG + Intergenic
905767866 1:40617516-40617538 GAATTTGACCAGGCCAGGTGCGG - Intergenic
906271425 1:44482296-44482318 GATCCAGACTAGACCAGGTCTGG - Intronic
906384538 1:45356341-45356363 GAGTGAGTTCAGGCCAGGTGTGG + Intronic
906859134 1:49340258-49340280 GATTTAGGCCAGGCAAGGTGGGG - Intronic
908546629 1:65168580-65168602 TATGGAGAGCAGGCCAGATGTGG - Intronic
909024265 1:70464353-70464375 GAGTAAGTCCAGGCCAGGTGTGG + Intergenic
909972409 1:82006622-82006644 GATGGAGGCTCGGCCAGGTGGGG + Intergenic
910586392 1:88885146-88885168 TATAGATACCAGGCCAGGTATGG + Intronic
911130349 1:94381452-94381474 GATTGAGACCTGGCCAGGCATGG + Intergenic
911463696 1:98223877-98223899 AAACGTGATCAGGCCAGGTGTGG + Intergenic
912403960 1:109420887-109420909 TATCCAGTCCACGCCAGGTGTGG + Intronic
913145538 1:115986131-115986153 AATTAAGACTAGGCCAGGTGTGG - Intronic
913468116 1:119163935-119163957 GATTGAGACCATGCCGGGCGTGG - Intergenic
913972395 1:143424506-143424528 GATCCAGGGGAGGCCAGGTGGGG - Intergenic
914066777 1:144250119-144250141 GATCCAGGGGAGGCCAGGTGGGG - Intergenic
914112376 1:144716235-144716257 GATCCAGGGGAGGCCAGGTGGGG + Intergenic
914907959 1:151762107-151762129 GATCCAGACCAAGGCAGGTGAGG - Exonic
915347343 1:155204297-155204319 ACTCGAGACCAGGCCGGGCGCGG + Intronic
915367015 1:155322294-155322316 GTTCGAGTCCAGGCCAGGATCGG - Exonic
915496953 1:156288626-156288648 TAACAAGAGCAGGCCAGGTGTGG - Intronic
915502019 1:156325871-156325893 GATCAAGAGAAGGCCAGGCGTGG - Intronic
915959719 1:160255422-160255444 GAGGGAGAAGAGGCCAGGTGTGG - Intronic
916232358 1:162553050-162553072 GATCCAGCCAAGGCCGGGTGTGG + Intergenic
916860134 1:168794911-168794933 GAAAGATAACAGGCCAGGTGTGG + Intergenic
917963604 1:180165132-180165154 GATCCAGACCATATCAGGTGGGG + Intronic
918223031 1:182453488-182453510 GATGGAGAGAAGGCCATGTGAGG + Intronic
919699527 1:200617256-200617278 GAGCCATAACAGGCCAGGTGTGG - Intronic
920325630 1:205161062-205161084 TAACATGACCAGGCCAGGTGTGG - Intronic
920445491 1:206012982-206013004 GATCCTGACCTGACCAGGTGTGG - Intronic
920969625 1:210732065-210732087 GAGGGAGCCCAGGCCAGCTGTGG + Intronic
921012404 1:211155529-211155551 GAAGGGGTCCAGGCCAGGTGCGG + Intergenic
922165640 1:223113494-223113516 GAGCAAGAATAGGCCAGGTGTGG - Intronic
922953670 1:229580688-229580710 GAATAAAACCAGGCCAGGTGCGG - Intergenic
922974096 1:229769295-229769317 GAAGGAGTCCAGGCCGGGTGTGG + Intergenic
923654757 1:235905940-235905962 GAAAGAGTCAAGGCCAGGTGTGG + Intergenic
923735942 1:236607746-236607768 GGTCGGGTCCCGGCCAGGTGCGG + Intergenic
924156484 1:241181980-241182002 GATAGAGAGCAGGCCAGGAATGG - Intronic
1063486522 10:6425510-6425532 GTGAGAGACCTGGCCAGGTGCGG - Intergenic
1063741721 10:8829590-8829612 GAAAAAGAACAGGCCAGGTGTGG - Intergenic
1063969637 10:11372586-11372608 AATCTAGCTCAGGCCAGGTGTGG - Intergenic
1064183739 10:13142281-13142303 TATTGAAACTAGGCCAGGTGCGG + Intergenic
1065773837 10:29101529-29101551 GAAAAAGACAAGGCCAGGTGTGG + Intergenic
1065781102 10:29168541-29168563 TATCTAAATCAGGCCAGGTGTGG + Intergenic
1066409874 10:35157338-35157360 TAAGGATACCAGGCCAGGTGTGG + Intronic
1066586213 10:36939403-36939425 AATATAGCCCAGGCCAGGTGCGG - Intergenic
1067081713 10:43216157-43216179 GGTGGGGACCAGGCCAGGTTGGG - Intronic
1067361081 10:45579721-45579743 TATCCACACCAGGCCAGGCGTGG + Intronic
1069446502 10:68477605-68477627 GATCAAGACCAGGCCAGGCACGG - Intergenic
1070389930 10:75960903-75960925 GATTAAAACCAGGCCGGGTGTGG - Intronic
1071431396 10:85609687-85609709 GATGGAAACCGGGCCAGGGGAGG + Intronic
1075362096 10:121847779-121847801 AATCGTGAACAGGCCAGGCGTGG + Intronic
1075902450 10:126053995-126054017 GACTGAGACCAGGCCAGGTACGG - Intronic
1076977011 11:180917-180939 TATAGATAGCAGGCCAGGTGTGG + Intronic
1077119103 11:898680-898702 AGTCCAGTCCAGGCCAGGTGGGG + Intronic
1077132619 11:980860-980882 GGTGGAGGCCAGGCCAGGAGAGG + Intronic
1077132987 11:983671-983693 AAAAGAGACTAGGCCAGGTGCGG - Intronic
1077808930 11:5617778-5617800 GATTGAGCCCAGGCCATGCGCGG - Intronic
1077908937 11:6557873-6557895 GAATGACACCGGGCCAGGTGGGG - Exonic
1077978185 11:7271864-7271886 GACCAAGCACAGGCCAGGTGCGG - Intronic
1078338769 11:10484348-10484370 TCCCGAGCCCAGGCCAGGTGAGG - Intronic
1081282660 11:41229237-41229259 CATAGAGACAAGGCCATGTGAGG + Intronic
1081696635 11:45115637-45115659 AAGCTAGAGCAGGCCAGGTGTGG + Intronic
1083400171 11:62418106-62418128 GATTTTGACCAGGCCAGGTTAGG + Intronic
1083606896 11:63984326-63984348 GAGCTAGGCAAGGCCAGGTGCGG + Intronic
1083732469 11:64660280-64660302 GTCAGAGACAAGGCCAGGTGAGG + Intronic
1083856293 11:65394603-65394625 GCTCCAGCCCAGGACAGGTGAGG - Intronic
1083890887 11:65595327-65595349 GATGGAGCCCAGGCCCTGTGAGG - Intronic
1084782522 11:71419738-71419760 TATTGAAACAAGGCCAGGTGAGG - Intergenic
1086399300 11:86447553-86447575 TAGAGAGACCAGGCCAGGTGTGG + Intronic
1087672249 11:101121874-101121896 GAATGAGGACAGGCCAGGTGTGG + Intronic
1089216411 11:116837175-116837197 GACCCAGATCAGGCCAGCTGTGG + Intronic
1089270657 11:117299600-117299622 AATGGAAACCAGGCCAGGAGTGG - Intronic
1089657148 11:119957471-119957493 AATAAAGACCTGGCCAGGTGCGG + Intergenic
1090268865 11:125371626-125371648 GAGCTAGGCCTGGCCAGGTGCGG + Intronic
1090865538 11:130697656-130697678 GAGGGAGCCCAGGCCAGCTGTGG - Intronic
1091408846 12:225971-225993 GAACAAAACGAGGCCAGGTGCGG + Intronic
1091419665 12:325721-325743 GAAGGAAACGAGGCCAGGTGTGG + Intronic
1091942978 12:4507140-4507162 GATTGAGATCATGACAGGTGTGG - Intronic
1092284014 12:7118363-7118385 GATCGGGACCAGGCCTGGGAGGG + Intergenic
1092346831 12:7722288-7722310 CATATAGATCAGGCCAGGTGAGG - Intergenic
1092734416 12:11566894-11566916 AATCAAAACTAGGCCAGGTGTGG - Intergenic
1094204610 12:27827066-27827088 GAATGATATCAGGCCAGGTGTGG - Intergenic
1096253133 12:50046158-50046180 GATCTAATCCAGGCCGGGTGCGG - Intergenic
1096412936 12:51390487-51390509 GATGAAAACCAGGTCAGGTGAGG - Intronic
1096741763 12:53698648-53698670 GACAGAGATGAGGCCAGGTGCGG - Intergenic
1098097490 12:66974212-66974234 AGTAAAGACCAGGCCAGGTGCGG - Intergenic
1098306724 12:69109771-69109793 GATCAAGGCCAGGCCAGGCATGG - Intergenic
1099384892 12:82002437-82002459 TATCAACATCAGGCCAGGTGCGG + Intergenic
1099610654 12:84864608-84864630 GATTAAGACTGGGCCAGGTGTGG - Intronic
1099855756 12:88163905-88163927 CATCAAAATCAGGCCAGGTGTGG + Intronic
1100494495 12:95111941-95111963 GAATGTGATCAGGCCAGGTGTGG + Intronic
1101134229 12:101723924-101723946 GATCTAGTCTAGGCCAGGCGTGG + Intronic
1102373492 12:112401986-112402008 GAGCGAACCCTGGCCAGGTGTGG - Intergenic
1102689169 12:114747098-114747120 GATAGAGGCCAGACCATGTGGGG - Intergenic
1102966440 12:117131342-117131364 GAGCAAGCCAAGGCCAGGTGCGG - Intergenic
1105500067 13:20964089-20964111 GCCTGAGACCAGGCCAGGCGTGG - Intergenic
1108502789 13:51083819-51083841 AATGAGGACCAGGCCAGGTGAGG + Intergenic
1113535130 13:111060224-111060246 TAGCAAGAACAGGCCAGGTGTGG + Intergenic
1113812240 13:113149840-113149862 AAGAGAGACCAGGCCAAGTGGGG - Intergenic
1117943028 14:60989431-60989453 TGTCTAAACCAGGCCAGGTGTGG + Intronic
1118106508 14:62666127-62666149 AATCCAGGACAGGCCAGGTGTGG + Intergenic
1118237985 14:64028190-64028212 GAACAACAACAGGCCAGGTGTGG - Intronic
1119240348 14:73054392-73054414 AATAGGGTCCAGGCCAGGTGTGG + Intergenic
1120186182 14:81395973-81395995 GGCCGAGGCCAGGTCAGGTGGGG + Exonic
1120209294 14:81619154-81619176 GATGGTGACAAGCCCAGGTGGGG - Intergenic
1120890211 14:89484845-89484867 GACCCAGGACAGGCCAGGTGTGG + Intronic
1121055794 14:90851326-90851348 TATCTTTACCAGGCCAGGTGCGG - Exonic
1121450250 14:94002442-94002464 GATACAGAACAGGCCAGGTGTGG - Intergenic
1122064560 14:99163202-99163224 AATTAAGACCAGGCCAGGCGTGG - Intergenic
1122428282 14:101624133-101624155 GGTTGGGGCCAGGCCAGGTGTGG - Intergenic
1122763370 14:104046934-104046956 GAAAAAGAGCAGGCCAGGTGCGG - Intronic
1122826805 14:104374551-104374573 GAGCTAGACGGGGCCAGGTGAGG + Intergenic
1123045669 14:105512597-105512619 GACAGAGACATGGCCAGGTGTGG - Intergenic
1123114191 14:105886533-105886555 GGTGAAGCCCAGGCCAGGTGAGG + Intergenic
1123114210 14:105886597-105886619 GGTGAAGCCCAGGCCAGGTGAGG + Intergenic
1123114234 14:105886677-105886699 GGTGAAGCCCAGGCCAGGTGAGG + Intergenic
1123114254 14:105886742-105886764 GGTGAAGCCCAGGCCAGGTGAGG + Intergenic
1123116408 14:105896141-105896163 GGTGAAGCCCAGGCCAGGTGAGG + Intergenic
1123118413 14:105905198-105905220 GGTGAAGTCCAGGCCAGGTGAGG + Intergenic
1123120643 14:105914842-105914864 GGTGAAGCCCAGGCCAGGTGAGG + Intergenic
1124029209 15:25994420-25994442 GACAGAGGCCAGCCCAGGTGAGG + Intergenic
1124139336 15:27063720-27063742 GAGCCAGCTCAGGCCAGGTGGGG + Intronic
1124842006 15:33250919-33250941 AATCAGGATCAGGCCAGGTGTGG - Intergenic
1124913258 15:33944022-33944044 AATTGTGACTAGGCCAGGTGTGG - Intronic
1125833950 15:42734907-42734929 AATTGAGATCGGGCCAGGTGTGG - Intronic
1126822636 15:52520018-52520040 AATAGAAGCCAGGCCAGGTGCGG - Intronic
1127561780 15:60145794-60145816 GAACAAAATCAGGCCAGGTGCGG - Intergenic
1129039518 15:72674097-72674119 AATAGAAATCAGGCCAGGTGCGG + Intergenic
1130385002 15:83403488-83403510 TATCCAGCCCAGGCCAGGCGCGG + Intergenic
1130508646 15:84570445-84570467 GATCGGGGCCAGGCCAGTCGCGG + Intergenic
1130834588 15:87637009-87637031 GATACAGAGCAGGCCAAGTGTGG + Intergenic
1131138354 15:89956576-89956598 GATATAGACAAAGCCAGGTGTGG + Intergenic
1131271013 15:90947714-90947736 GAGGGAGTCCAAGCCAGGTGTGG + Intronic
1131487028 15:92829270-92829292 GACAGAGTCCCGGCCAGGTGCGG - Intergenic
1132487094 16:199479-199501 GATCAAGACCAGGCCAGGCGCGG + Intronic
1132879551 16:2155936-2155958 GATCGAGGCGAGGCGAGGCGAGG + Intronic
1132980134 16:2734313-2734335 GATCCAAACATGGCCAGGTGTGG - Intergenic
1133961271 16:10495616-10495638 GAGGTAGACTAGGCCAGGTGTGG + Intergenic
1136355038 16:29739080-29739102 AATATAGTCCAGGCCAGGTGTGG + Intergenic
1138375728 16:56562859-56562881 TATCAAAACCAGGCCAGATGTGG - Intergenic
1138615237 16:58160132-58160154 GGTGGAGACCAGGGCAGGGGAGG - Intronic
1139428465 16:66897969-66897991 AATAGAAACAAGGCCAGGTGTGG + Intergenic
1140077421 16:71714506-71714528 CATGGAGACCTGGTCAGGTGAGG - Exonic
1140754281 16:78053577-78053599 AATAGAAAGCAGGCCAGGTGTGG - Intronic
1140768098 16:78178573-78178595 AATAGATAGCAGGCCAGGTGCGG + Intronic
1140813783 16:78602520-78602542 TATCGAGAAGAGGCCGGGTGTGG - Intronic
1141154727 16:81589385-81589407 AAGCAAGACAAGGCCAGGTGTGG - Intronic
1141603732 16:85141501-85141523 TAGCCAGACAAGGCCAGGTGCGG - Intergenic
1142243255 16:88956663-88956685 AACAGACACCAGGCCAGGTGGGG - Intronic
1142443245 16:90115753-90115775 TATAGATAGCAGGCCAGGTGTGG - Intergenic
1142464149 17:119091-119113 TATAGATAGCAGGCCAGGTGTGG + Intergenic
1143308186 17:5965605-5965627 GATCAGGAACAGGCCAGGCGCGG - Intronic
1144264189 17:13552369-13552391 GTTCAAGAACCGGCCAGGTGCGG - Intronic
1146908324 17:36632135-36632157 CCTCTAGAACAGGCCAGGTGTGG - Intergenic
1147234688 17:39048663-39048685 GAGGCAGACTAGGCCAGGTGAGG + Intergenic
1147730026 17:42593898-42593920 TATAGAGCCCTGGCCAGGTGTGG + Intronic
1147779291 17:42928636-42928658 GAAGGAGACCAGGTGAGGTGCGG - Intergenic
1147918642 17:43902993-43903015 AATTAAGAACAGGCCAGGTGTGG + Intronic
1148628122 17:49085964-49085986 GTTCGAGACCATCCCGGGTGTGG + Intergenic
1148668609 17:49393312-49393334 GATACAGACTGGGCCAGGTGCGG - Intronic
1149490368 17:57080320-57080342 GCTCGATACGTGGCCAGGTGCGG - Intergenic
1149792639 17:59492811-59492833 AATCTAGTCCAGGCCGGGTGTGG + Intergenic
1151035366 17:70792622-70792644 GACCCAGAGCAGGCCAGGTGCGG - Intergenic
1151467071 17:74292700-74292722 GACTGAAATCAGGCCAGGTGTGG - Intronic
1151516525 17:74599634-74599656 GATGGAGCCCAGGCCAGGCCTGG + Intergenic
1151595283 17:75074609-75074631 GATCCAGACAATGCGAGGTGAGG + Intergenic
1151769527 17:76151016-76151038 GATGGAAGCCAGGCCAGGAGCGG + Intronic
1152014773 17:77743351-77743373 ACTTGAGAGCAGGCCAGGTGTGG + Intergenic
1153639728 18:7146497-7146519 TATCTAGAAGAGGCCAGGTGCGG + Intergenic
1153725950 18:7955341-7955363 GCTCCTGACCAGGCCAGGGGAGG + Exonic
1153841537 18:9012273-9012295 AAACCAGAACAGGCCAGGTGCGG - Intergenic
1155477198 18:26246821-26246843 GAATGAGATTAGGCCAGGTGCGG - Intronic
1158458456 18:57627496-57627518 AATCGTGTCCTGGCCAGGTGCGG - Intergenic
1160744995 19:707136-707158 GTTTGAGACCAGGCCGGGCGCGG - Intergenic
1161346058 19:3769376-3769398 AAGCTAAACCAGGCCAGGTGCGG - Exonic
1162152093 19:8653936-8653958 AATCAACACCAGGCCAGGCGTGG + Intergenic
1162259738 19:9522727-9522749 GATTGAAAAGAGGCCAGGTGTGG + Intergenic
1162430756 19:10626710-10626732 AATTAAGTCCAGGCCAGGTGTGG - Intronic
1162598261 19:11646163-11646185 AATGTAGAACAGGCCAGGTGCGG - Intergenic
1163119901 19:15211181-15211203 GAAAGAGAGCAGGCCAGGCGTGG - Intergenic
1163492828 19:17626901-17626923 AATGGAGAACAGGCCAGATGCGG + Intronic
1164150253 19:22544350-22544372 GATCTACACTAGGCCAGGTAGGG - Intergenic
1164325362 19:24186595-24186617 GATTGTGACTTGGCCAGGTGTGG - Intergenic
1164490774 19:28712183-28712205 GATCCAAACAAGGCCAGCTGTGG + Intergenic
1164686564 19:30169943-30169965 GATCGGGACCAGGTCTGGGGAGG - Intergenic
1165094235 19:33401935-33401957 CCTCGAGTCCAGGGCAGGTGGGG - Intronic
1165278049 19:34772003-34772025 GTTAGAGAACAGACCAGGTGAGG + Intronic
1165725039 19:38106782-38106804 GTTAGAGAGCAGCCCAGGTGTGG + Intronic
1165966317 19:39584062-39584084 GAGAGGGGCCAGGCCAGGTGCGG - Intergenic
1166042400 19:40212013-40212035 AATCCATACCAGGCCAGGTGCGG - Intronic
1166042428 19:40212154-40212176 GATGGAGGCCAGGCCAGGGTGGG + Intronic
1166200182 19:41232329-41232351 AACCAAAACCAGGCCAGGTGTGG + Intronic
1166282883 19:41806975-41806997 GACCAAGACAAGGCCGGGTGCGG - Intronic
1166307104 19:41941084-41941106 GATCGGGGCCAGGCGTGGTGGGG - Intergenic
1166635089 19:44444223-44444245 GAAAGAGGCCAGGCAAGGTGGGG - Intronic
1166874908 19:45891161-45891183 GGTGGAGACAAGGCCAGGCGAGG + Exonic
1166921440 19:46231514-46231536 CATCGGGAGCAGCCCAGGTGGGG + Intergenic
1167284868 19:48593259-48593281 GAGAGAGAGAAGGCCAGGTGTGG + Intronic
1168095202 19:54110434-54110456 GAAACACACCAGGCCAGGTGCGG + Intronic
1168660696 19:58163628-58163650 CATGGAAATCAGGCCAGGTGTGG - Intergenic
925234625 2:2267057-2267079 GAACCAGAGCAAGCCAGGTGGGG + Intronic
925303640 2:2834417-2834439 GCTCGTGACCCGGACAGGTGTGG - Intergenic
925439232 2:3869460-3869482 TAGCAAGACTAGGCCAGGTGTGG + Intergenic
926043243 2:9691515-9691537 GATGGTGGCCAAGCCAGGTGAGG - Intergenic
927385187 2:22524428-22524450 GATCCAGACAAGGCCAGGCCTGG - Intergenic
927419783 2:22918445-22918467 GATAGAGATTAGGCCGGGTGTGG + Intergenic
927500553 2:23580078-23580100 AATCTAGACCAGGCCGGGCGCGG + Intronic
927721169 2:25383507-25383529 AAGCAAGACCAGGCCAGGTGCGG - Intronic
927756586 2:25713352-25713374 GAGCAACACCAGGCCAGGTGCGG + Intergenic
927812266 2:26186683-26186705 GATTAAGTTCAGGCCAGGTGCGG + Intronic
928299408 2:30112190-30112212 GCTGTAGAGCAGGCCAGGTGCGG + Intergenic
928650377 2:33397810-33397832 GATGGAGAAGAGGCCAGGCGTGG - Intronic
930053067 2:47231631-47231653 GAACTAGGACAGGCCAGGTGTGG + Intergenic
930179402 2:48337594-48337616 GAATGAGATCAGGCCAGGCGTGG - Intronic
930200638 2:48549349-48549371 GATGGAGTCCAGGCCTGGGGTGG + Intronic
930824883 2:55686922-55686944 GATTGAGACCAGGCCAGGCGCGG + Intronic
931387534 2:61810748-61810770 GCTGGGGACCAGGGCAGGTGTGG - Intergenic
934177088 2:89585444-89585466 GATCCAGGGGAGGCCAGGTGGGG - Intergenic
934287395 2:91659803-91659825 GATCCAGGGGAGGCCAGGTGGGG - Intergenic
935232447 2:101110684-101110706 GAACCAGAACAGGCCAGGCGCGG + Intronic
935239141 2:101163327-101163349 GACCGAACCCAGGCCAGGCGCGG + Intronic
937233590 2:120416916-120416938 GATTCAGCCCTGGCCAGGTGTGG - Intergenic
937587186 2:123567040-123567062 GAAAGAAATCAGGCCAGGTGCGG + Intergenic
939579511 2:143931254-143931276 AATAAAGACAAGGCCAGGTGTGG - Intergenic
941821738 2:169850467-169850489 GATCCAGAGCAGGCCGGGTGCGG - Intronic
941869656 2:170370926-170370948 GAAAAAGAACAGGCCAGGTGCGG + Intronic
942395375 2:175541503-175541525 AATCAAGATCAGGCCAGGTGCGG - Intergenic
942477260 2:176340445-176340467 TATCACAACCAGGCCAGGTGTGG - Intergenic
942577793 2:177383267-177383289 AATTGAGACCCAGCCAGGTGTGG - Intronic
943579150 2:189663541-189663563 GATATACACCAGGCCGGGTGCGG - Intronic
943614274 2:190074359-190074381 AATAGAGAAAAGGCCAGGTGCGG + Intronic
944158532 2:196634742-196634764 AATAAAGACCAGGCCAGGTGCGG + Intergenic
945682493 2:212931061-212931083 GACAGTTACCAGGCCAGGTGTGG + Intergenic
946458780 2:219851258-219851280 GACTGAGTCCAGGCCTGGTGGGG - Intergenic
946578404 2:221101200-221101222 AATAGAGTCCAGGCCGGGTGCGG + Intergenic
947508382 2:230727946-230727968 AAACTAGCCCAGGCCAGGTGTGG + Intronic
947712474 2:232323931-232323953 GTTCCAGGCCAGGCCGGGTGGGG - Intronic
947731433 2:232433611-232433633 GTTCCAGGCCAGGCCGGGTGGGG - Intergenic
947992204 2:234496855-234496877 GAGCGAGCCCAGGCCTGGGGAGG - Exonic
948211384 2:236195804-236195826 GAGTGAGAACAGGCCAGGTGCGG - Intronic
1170396010 20:15926316-15926338 TATCCAGACAAGGCCAGGTAAGG + Intronic
1171472057 20:25380012-25380034 CATCGTTACAAGGCCAGGTGCGG - Intronic
1173524016 20:43718421-43718443 GATAGAAACCAGGCCAGGTGTGG + Intergenic
1173793117 20:45840938-45840960 GATAGAGGCCAGTACAGGTGAGG - Exonic
1174091903 20:48055908-48055930 GATGGAGAACTGGCCAAGTGAGG - Intergenic
1174413157 20:50349163-50349185 GATGGAGATCCGGCCGGGTGTGG - Intergenic
1175300805 20:57941436-57941458 GATCCAGGCCAGGCAGGGTGGGG + Intergenic
1175528791 20:59659659-59659681 GCTCCAGACCCGGCCAGTTGCGG - Intronic
1175637938 20:60601161-60601183 AATCGAGACCAGGCCGGGTGTGG - Intergenic
1176020798 20:62961482-62961504 GATCGAGGCCAGGCCAGGGGTGG + Intronic
1178101378 21:29271983-29272005 AATCCAGACTAGGCCAGGTGTGG - Intronic
1178451804 21:32708544-32708566 GATCGACAGCAGTTCAGGTGAGG + Intronic
1179191160 21:39122803-39122825 GAACAAGGCTAGGCCAGGTGCGG + Intergenic
1180174799 21:46082334-46082356 CCCCGAGGCCAGGCCAGGTGGGG + Intergenic
1180658169 22:17442271-17442293 AATGCAGATCAGGCCAGGTGTGG + Intronic
1180928506 22:19572983-19573005 GAAAGAGAAAAGGCCAGGTGCGG - Intergenic
1181042438 22:20198474-20198496 GAGGGAGACCAGGCGGGGTGGGG - Intergenic
1181067080 22:20311820-20311842 GATGGAGAACAGGGGAGGTGAGG + Intergenic
1181136360 22:20769377-20769399 TATCAAGGTCAGGCCAGGTGTGG + Intronic
1181163407 22:20970891-20970913 AATGGAGAGAAGGCCAGGTGTGG - Intronic
1181576742 22:23800117-23800139 GTTCGAAACCAGGCCAGGTGCGG - Intronic
1181613684 22:24036967-24036989 CATGGAAACCAGGCCGGGTGCGG + Intronic
1181994414 22:26864130-26864152 GATCCACAGCATGCCAGGTGGGG - Intergenic
1182272870 22:29166646-29166668 GACCAAGATCAGGCCAGGCGCGG + Intronic
1182365154 22:29773707-29773729 GACCTAAACCAGGCCAGGCGCGG + Intergenic
1182467974 22:30529732-30529754 AATCGGCACTAGGCCAGGTGCGG - Intronic
1183151496 22:36041407-36041429 GAACAAGAACAGGCCAGGCGCGG + Intergenic
1183503630 22:38196237-38196259 AATCGAGACCGTGGCAGGTGAGG - Intronic
1184159455 22:42689224-42689246 AAACGAGACCAGGCCAGGCACGG + Intergenic
1184206860 22:43010246-43010268 GATTGAAAATAGGCCAGGTGTGG + Intronic
1184254226 22:43278039-43278061 GCTCAAGGCCAGGCCAGGAGAGG + Intronic
1184466981 22:44674430-44674452 GTTCAAGACCAGGCCGGGTACGG + Intronic
1184655952 22:45942133-45942155 GATTGAGACCAAGGGAGGTGAGG + Intronic
1185220229 22:49625828-49625850 GAGAGAGACTGGGCCAGGTGCGG + Intronic
1185270981 22:49929279-49929301 GGTCGGGGCCAGGCCAGGAGAGG + Intergenic
950119657 3:10473339-10473361 TATGAAGAGCAGGCCAGGTGTGG + Intronic
950634947 3:14308003-14308025 GATGGAGACCAGGCCAGCACGGG - Intergenic
951810439 3:26693038-26693060 GATCAAGAGCAGGCCGGGCGCGG + Intronic
952619262 3:35316704-35316726 GATAAGGACCAGGCCAGGTGTGG + Intergenic
953047002 3:39302855-39302877 GATATAGACTTGGCCAGGTGTGG + Intergenic
953723751 3:45379818-45379840 GATACAGACCTGGCCAGGTGTGG - Intergenic
954350290 3:50037705-50037727 GCTCGAGACCAGACCAGCTCAGG - Intronic
956518696 3:70080125-70080147 GATCCAGACTAGGTGAGGTGAGG + Intergenic
959667176 3:108935101-108935123 GAGCAAGAACAGGCCAGGTGTGG - Intronic
961073541 3:123961138-123961160 GAGCTCGACCGGGCCAGGTGAGG - Exonic
961689166 3:128656023-128656045 GATCGAAACCAGGCTGGGCGCGG + Intronic
961751215 3:129095896-129095918 GATGGATACCAGGCCAGGTAGGG + Intronic
962517092 3:136162290-136162312 GAGGGCTACCAGGCCAGGTGTGG + Intronic
963903532 3:150755157-150755179 GATTTGGACCAGGCCAGATGAGG + Intronic
964729165 3:159846466-159846488 TATCGACACCAGGACAAGTGAGG + Intronic
966354444 3:179064719-179064741 GGCTAAGACCAGGCCAGGTGTGG - Intronic
967060007 3:185863883-185863905 CATAAAGACCTGGCCAGGTGTGG + Intergenic
967387957 3:188928918-188928940 GCTCTGGGCCAGGCCAGGTGTGG + Intergenic
968363562 3:198167141-198167163 TATAGATAGCAGGCCAGGTGTGG - Intergenic
968798389 4:2725167-2725189 AATAGAGACAGGGCCAGGTGTGG - Intronic
968978589 4:3834739-3834761 ATCCGAGGCCAGGCCAGGTGAGG + Intergenic
971306086 4:25482910-25482932 GTTCGAGACCAGGCTGGGTGCGG + Intergenic
971461587 4:26904583-26904605 GATCTTGACCAGGCCAGTTTTGG + Intronic
972086515 4:35223747-35223769 AATGGAAAACAGGCCAGGTGTGG + Intergenic
973622395 4:52740748-52740770 AATGAGGACCAGGCCAGGTGCGG + Intronic
973653075 4:53016816-53016838 GATCAAGATCTGGCCAGGTGCGG + Intronic
973769874 4:54196681-54196703 GATGAAAAACAGGCCAGGTGCGG + Intronic
973980718 4:56306201-56306223 GATAAATATCAGGCCAGGTGTGG + Intronic
976880782 4:89922394-89922416 TATTGAGTACAGGCCAGGTGCGG - Intronic
977762077 4:100750242-100750264 AATACAGCCCAGGCCAGGTGTGG - Intronic
978892503 4:113847021-113847043 GAGCCACACTAGGCCAGGTGCGG - Intergenic
981193647 4:141892841-141892863 AACTGAGACCTGGCCAGGTGTGG - Intergenic
981548944 4:145923312-145923334 GATTGAATGCAGGCCAGGTGCGG + Intronic
984270519 4:177543442-177543464 TATAAAGGCCAGGCCAGGTGTGG + Intergenic
985567985 5:629962-629984 GATTTAGACCAGTCCTGGTGGGG + Intronic
985568015 5:630079-630101 GATTTAGACCAGTCCTGGTGGGG + Intronic
985568210 5:630743-630765 GATTTAGACCAGTCCTGGTGGGG + Intronic
985568254 5:630899-630921 GATTTAGACCAGTCCTGGTGGGG + Intronic
985568355 5:631249-631271 GATTTAGACCAGTCCTGGTGGGG + Intronic
985568477 5:631678-631700 GATTTAGACCAGTCCTGGTGGGG + Intronic
985568496 5:631755-631777 GATTTAGACCAGTCCTGGTGGGG + Intronic
985568518 5:631833-631855 GATTTAGACCAGTCCTGGTGGGG + Intronic
985568594 5:632105-632127 GATTTAGACCAGTCCTGGTGGGG + Intronic
985568637 5:632261-632283 GATTTAGACCAGTCCTGGTGGGG + Intronic
985568667 5:632378-632400 GATTTAGACCAGTCCTGGTGGGG + Intronic
985568746 5:632651-632673 GATTTAGACCAGTCCTGGTGGGG + Intronic
985568833 5:632963-632985 GATTTAGACCAGTCCTGGTGGGG + Intronic
985568855 5:633041-633063 GATTTAGACCAGTCCTGGTGGGG + Intronic
985568876 5:633119-633141 GATTTAGACCAGTCCTGGTGGGG + Intronic
985568898 5:633197-633219 GATTTAGACCAGTCCTGGTGGGG + Intronic
985568917 5:633274-633296 GATTTAGACCAGTCCTGGTGGGG + Intronic
985568957 5:633429-633451 GATTTAGACCAGTCCTGGTGGGG + Intronic
988526256 5:31989712-31989734 GGTATACACCAGGCCAGGTGTGG - Intronic
988536333 5:32072438-32072460 GCTGGAGACCAGGCCGGGCGCGG + Intronic
989160725 5:38388327-38388349 AATGCAAACCAGGCCAGGTGTGG + Intronic
989381893 5:40817468-40817490 GTTCGAGACCAGGCTGGGCGTGG + Intergenic
990003052 5:50917669-50917691 GGTCGAGTCGTGGCCAGGTGCGG + Intergenic
991221991 5:64227408-64227430 GTTCGGGACCAGGACATGTGTGG - Intronic
995433821 5:112113119-112113141 GAAAGAGCCCAGGCCAGGCGTGG + Intergenic
995879290 5:116826084-116826106 GATGCAGATCAGGCCAGGCGCGG + Intergenic
995999441 5:118341285-118341307 GATCCAGTAGAGGCCAGGTGCGG + Intergenic
997212916 5:132087968-132087990 GAGCAATTCCAGGCCAGGTGAGG + Intergenic
997469849 5:134111334-134111356 CATCCAGACCAGGCCAGGGCTGG - Intergenic
997787712 5:136728762-136728784 GTTGGAGGCCAGGGCAGGTGTGG + Intergenic
998058944 5:139104071-139104093 AATCTGGACCAGACCAGGTGTGG - Intronic
998350683 5:141498639-141498661 GAAGAAGACCTGGCCAGGTGTGG + Intronic
1001076108 5:168629164-168629186 GACTGAGATAAGGCCAGGTGTGG + Intergenic
1002282102 5:178137125-178137147 GATGGAGAGCAGGCCAGGTGAGG + Intronic
1002522571 5:179799804-179799826 CAATGAGAACAGGCCAGGTGGGG + Intronic
1003039024 6:2670073-2670095 GATTAAGACCAGGCCAGGCCCGG + Intronic
1003150410 6:3543187-3543209 GATGGTGTCCACGCCAGGTGTGG + Intergenic
1003302552 6:4897624-4897646 TCAGGAGACCAGGCCAGGTGTGG + Intronic
1003887282 6:10533014-10533036 TAACTAGTCCAGGCCAGGTGTGG + Intronic
1004256098 6:14066018-14066040 AATCCAGACAAGGCCGGGTGCGG + Intergenic
1004604002 6:17176866-17176888 GATAAAGACCAGGCCAGGCATGG - Intergenic
1004759302 6:18648419-18648441 GGTCAACTCCAGGCCAGGTGCGG + Intergenic
1004791146 6:19027750-19027772 GATGGAGCCTTGGCCAGGTGTGG - Intergenic
1006073285 6:31512355-31512377 AAAAGAGAACAGGCCAGGTGCGG - Intergenic
1006323204 6:33333180-33333202 GAACAAGATCAGGCCAGGCGCGG + Intergenic
1006427868 6:33977420-33977442 GATCCTGTCCTGGCCAGGTGTGG - Intergenic
1007031314 6:38629915-38629937 AAAGGAGACCAGGCCAGGCGTGG + Intronic
1007435707 6:41809199-41809221 TAAAGAGACTAGGCCAGGTGTGG - Intronic
1008933528 6:56964784-56964806 GACTGAGAAGAGGCCAGGTGAGG - Intronic
1010632640 6:78216809-78216831 GAACCAGACCAAGCCAGGAGTGG - Intergenic
1010976758 6:82324406-82324428 TATCAATATCAGGCCAGGTGCGG + Intergenic
1011567243 6:88689307-88689329 AGTCTATACCAGGCCAGGTGTGG + Intronic
1011616507 6:89202581-89202603 GAGCAACACCTGGCCAGGTGTGG - Intronic
1011688655 6:89845204-89845226 TACTGATACCAGGCCAGGTGCGG - Intronic
1013139857 6:107322227-107322249 ACTTGAGGCCAGGCCAGGTGTGG + Intronic
1013802859 6:113967417-113967439 TATCAAGATTAGGCCAGGTGTGG - Intronic
1014780834 6:125562756-125562778 GATGTATACCAGGCCAGATGGGG + Intergenic
1015422804 6:133030359-133030381 GGTGCAGAACAGGCCAGGTGCGG - Intergenic
1016325092 6:142892052-142892074 CAGTGAGGCCAGGCCAGGTGAGG - Intronic
1017680687 6:156861308-156861330 AAACTAGACCAGGCCAGGCGTGG + Intronic
1017925556 6:158909090-158909112 GATCGAGACCAGGCCAGGTGTGG + Intronic
1017992351 6:159502596-159502618 GAGCAAGACCAGGCCAGAGGTGG - Intergenic
1019252138 7:21542-21564 TATAGATAGCAGGCCAGGTGTGG + Intergenic
1019517662 7:1446922-1446944 GATGGAGAACTGGCCAGGAGAGG + Intronic
1020063495 7:5169959-5169981 GGTCAAGAGCAGGCCAGGTATGG + Intergenic
1020200047 7:6072580-6072602 GATAGAGTCATGGCCAGGTGCGG - Intergenic
1020258868 7:6519465-6519487 AAACCAAACCAGGCCAGGTGCGG + Intronic
1020803651 7:12761790-12761812 GACTGAGAACAGGCCGGGTGCGG - Intergenic
1021473006 7:21028210-21028232 GATCGAGGCGAGGGCAGCTGAGG - Intergenic
1021651782 7:22839877-22839899 ATTCAAGACCTGGCCAGGTGCGG - Intergenic
1022002033 7:26235111-26235133 GAACTATACAAGGCCAGGTGTGG - Intergenic
1022734702 7:33064826-33064848 GAAAGAAATCAGGCCAGGTGAGG + Intergenic
1023276062 7:38519734-38519756 GATCAAGCCCAGGCCATGTCAGG + Intronic
1023634879 7:42199763-42199785 GACCTATACCTGGCCAGGTGTGG + Intronic
1024291896 7:47811087-47811109 GATCAAGATCAAGCCTGGTGAGG - Intronic
1025063882 7:55836029-55836051 TATGGTAACCAGGCCAGGTGTGG - Intronic
1026220441 7:68391977-68391999 GAAAGAGAAAAGGCCAGGTGTGG + Intergenic
1026781041 7:73267673-73267695 AATCAAGCACAGGCCAGGTGTGG - Intergenic
1026896579 7:74013173-74013195 GACGGGGACCAGGCCAGGTCAGG + Intergenic
1027021895 7:74821115-74821137 AATCAAGCACAGGCCAGGTGTGG - Intronic
1027066126 7:75124802-75124824 AATCAAGCACAGGCCAGGTGTGG + Intronic
1027240340 7:76323522-76323544 AACCGATACTAGGCCAGGTGTGG - Intergenic
1027353838 7:77337858-77337880 AATCAAGGGCAGGCCAGGTGTGG + Intronic
1029112895 7:98222653-98222675 CACCGAGATCAGGCCGGGTGGGG - Intronic
1029472992 7:100766275-100766297 GATCTATCCGAGGCCAGGTGTGG - Intronic
1029495443 7:100893786-100893808 GATCCAGACGAGGACAGGGGTGG + Exonic
1029537860 7:101166477-101166499 GGGCGAGACCAGAGCAGGTGGGG + Intergenic
1029594035 7:101527259-101527281 GAGAGAGAGCAGGCCAGGTGGGG - Intronic
1031926418 7:127642863-127642885 AGTCAAGAGCAGGCCAGGTGCGG - Intergenic
1031975102 7:128088741-128088763 GACAGGGACTAGGCCAGGTGTGG - Intronic
1032165417 7:129541130-129541152 GAGCAAGACCAGGCCAGGCATGG - Intergenic
1036548105 8:9791637-9791659 GGTTGAGACCTGGCCAGGTGCGG + Intergenic
1037319336 8:17629131-17629153 GGTCGAGACCAGCCCAGGCAAGG - Intronic
1038173527 8:25160513-25160535 GAAAGTGACCAGGGCAGGTGAGG + Intergenic
1038192312 8:25334428-25334450 GATCCAGAATAGGCCAGGCGTGG + Intronic
1038600836 8:28940296-28940318 AATCTAAAACAGGCCAGGTGCGG - Intronic
1039534597 8:38297249-38297271 GATTGAGACCAAAACAGGTGTGG + Intronic
1039782877 8:40804548-40804570 TATTAAGACCAGGCCAGGAGCGG + Intronic
1039956864 8:42214504-42214526 TAACAACACCAGGCCAGGTGAGG + Intergenic
1041069350 8:54111915-54111937 GAACCAGACCAGTCCAGATGAGG - Intergenic
1042986475 8:74589351-74589373 ATTGTAGACCAGGCCAGGTGTGG - Intergenic
1043142151 8:76603546-76603568 GATCCAGACCAAGGCAGGTGAGG - Intergenic
1045015756 8:98000306-98000328 TATGGATAACAGGCCAGGTGCGG + Intronic
1045526410 8:102944363-102944385 AATGGAGAACAGGCCGGGTGTGG + Intronic
1045867300 8:106882506-106882528 AAAGGAGACCAGGCCGGGTGCGG - Intergenic
1046068293 8:109221758-109221780 GAACAAGACAGGGCCAGGTGCGG + Intergenic
1047250349 8:123177523-123177545 GTCGGAGCCCAGGCCAGGTGAGG - Intergenic
1047527106 8:125643064-125643086 GATCTAGAGCAGGCCAGCTCAGG - Intergenic
1047768050 8:128005401-128005423 GATGGAGACTGGGCCAGGTGGGG + Intergenic
1048580228 8:135724420-135724442 GATCTACACCAGGCGTGGTGTGG - Intergenic
1049024426 8:139979064-139979086 GGTTGACAGCAGGCCAGGTGCGG + Intronic
1050351545 9:4744918-4744940 AATCCACTCCAGGCCAGGTGTGG + Intergenic
1050841291 9:10152533-10152555 GAAGGAAATCAGGCCAGGTGTGG + Intronic
1051277915 9:15414945-15414967 AATCTAGACCAGGCCGGGCGCGG + Intergenic
1051520539 9:17982322-17982344 GAATAAAACCAGGCCAGGTGTGG + Intergenic
1052906343 9:33837708-33837730 AAACAAGAACAGGCCAGGTGTGG - Intronic
1053479267 9:38403849-38403871 GGTTAAGAACAGGCCAGGTGCGG - Intergenic
1054392201 9:64625938-64625960 AAGGCAGACCAGGCCAGGTGCGG + Intergenic
1055019082 9:71649744-71649766 CGTCCAGACCAGACCAGGTGTGG + Intergenic
1056327506 9:85492165-85492187 AATTGAGAACAGGCCAGGCGTGG + Intergenic
1056416039 9:86377033-86377055 TATCAAGGCCGGGCCAGGTGTGG - Intergenic
1057111041 9:92471483-92471505 GATCAAGACCCGGCTGGGTGCGG - Intronic
1057183788 9:93044564-93044586 CATCAAGAACAGGCCAGGTGCGG + Intergenic
1057251466 9:93506890-93506912 AATCGTGCCCCGGCCAGGTGTGG - Intronic
1059310559 9:113386098-113386120 GATTGAGATAAGGACAGGTGTGG - Intergenic
1060151003 9:121288216-121288238 GACAGAAAGCAGGCCAGGTGAGG - Intronic
1060382361 9:123188348-123188370 TCTCAAGACTAGGCCAGGTGCGG + Intronic
1061091029 9:128426332-128426354 AATCCAGTCCTGGCCAGGTGCGG + Intronic
1061092171 9:128432855-128432877 GCAGGAGGCCAGGCCAGGTGCGG + Intronic
1061772531 9:132937151-132937173 GCAGGAGCCCAGGCCAGGTGTGG + Intronic
1061812572 9:133171013-133171035 GATGGGGGACAGGCCAGGTGTGG + Intergenic
1061885089 9:133587405-133587427 GGTGGGGACCAGGCCAGGGGGGG - Intergenic
1062578436 9:137219162-137219184 GATCAGGCCCAGACCAGGTGGGG + Intergenic
1062748203 9:138230373-138230395 TATAGATAGCAGGCCAGGTGTGG - Intergenic
1203759301 EBV:3730-3752 GGTCTGGACCAGGCCCGGTGGGG + Intergenic
1185471184 X:384692-384714 GACTGATTCCAGGCCAGGTGTGG + Intronic
1187321821 X:18246029-18246051 GAGCCAGAACAGGCCAGGCGCGG - Intronic
1187416307 X:19096118-19096140 GAAATGGACCAGGCCAGGTGCGG + Intronic
1187507376 X:19888073-19888095 GATGGAGACCAGGGCAGGCCCGG + Intergenic
1187819954 X:23276785-23276807 AATGGAGACAAGGCCAGATGTGG + Intergenic
1187870512 X:23761111-23761133 AATTGAGGCCAGGCCGGGTGTGG - Intronic
1189105361 X:38230084-38230106 GAAGTAGCCCAGGCCAGGTGCGG + Intronic
1190833160 X:54077399-54077421 AATGGGGAACAGGCCAGGTGTGG + Intronic
1196186420 X:112749220-112749242 GATCTAGATCAGGACAGGTATGG - Intergenic
1196630003 X:117927275-117927297 GATCCAGGCCAGGCCGGGAGGGG - Intronic
1200206243 X:154318407-154318429 GTTCGAGACCAGGCCGGGTGCGG + Intronic
1201381008 Y:13378982-13379004 TATTAAGACCAGGCCTGGTGGGG - Intronic