ID: 1017930080

View in Genome Browser
Species Human (GRCh38)
Location 6:158944562-158944584
Sequence ACATTGAAACAGAGGGAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017930080_1017930084 -8 Left 1017930080 6:158944562-158944584 CCATGCTCCCTCTGTTTCAATGT No data
Right 1017930084 6:158944577-158944599 TTCAATGTCCTGAGGCCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017930080 Original CRISPR ACATTGAAACAGAGGGAGCA TGG (reversed) Intergenic
No off target data available for this crispr