ID: 1017934132

View in Genome Browser
Species Human (GRCh38)
Location 6:158989534-158989556
Sequence GTTCAGCAGCACCACATTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 4, 1: 11, 2: 26, 3: 43, 4: 151}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017934132_1017934133 -7 Left 1017934132 6:158989534-158989556 CCTACAATGTGGTGCTGCTGAAC 0: 4
1: 11
2: 26
3: 43
4: 151
Right 1017934133 6:158989550-158989572 GCTGAACAGCCACTCTGATTTGG No data
1017934132_1017934135 5 Left 1017934132 6:158989534-158989556 CCTACAATGTGGTGCTGCTGAAC 0: 4
1: 11
2: 26
3: 43
4: 151
Right 1017934135 6:158989562-158989584 CTCTGATTTGGTGTTTCCTTTGG 0: 2
1: 18
2: 35
3: 95
4: 338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017934132 Original CRISPR GTTCAGCAGCACCACATTGT AGG (reversed) Intronic