ID: 1017936847

View in Genome Browser
Species Human (GRCh38)
Location 6:159013238-159013260
Sequence GAACAATGCTGGTCTTAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017936847_1017936854 19 Left 1017936847 6:159013238-159013260 CCACTTTAAGACCAGCATTGTTC No data
Right 1017936854 6:159013280-159013302 GTATTTGATTGGCCTCCATGTGG No data
1017936847_1017936852 8 Left 1017936847 6:159013238-159013260 CCACTTTAAGACCAGCATTGTTC No data
Right 1017936852 6:159013269-159013291 CCCACACACAGGTATTTGATTGG No data
1017936847_1017936850 -3 Left 1017936847 6:159013238-159013260 CCACTTTAAGACCAGCATTGTTC No data
Right 1017936850 6:159013258-159013280 TTCATGCTGGACCCACACACAGG No data
1017936847_1017936855 24 Left 1017936847 6:159013238-159013260 CCACTTTAAGACCAGCATTGTTC No data
Right 1017936855 6:159013285-159013307 TGATTGGCCTCCATGTGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017936847 Original CRISPR GAACAATGCTGGTCTTAAAG TGG (reversed) Intergenic
No off target data available for this crispr