ID: 1017945797

View in Genome Browser
Species Human (GRCh38)
Location 6:159095495-159095517
Sequence GACAACATCACACAGGTAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017945797_1017945802 -4 Left 1017945797 6:159095495-159095517 CCCACTACCTGTGTGATGTTGTC No data
Right 1017945802 6:159095514-159095536 TGTCCCAGGGATTCAGCCTCTGG No data
1017945797_1017945807 20 Left 1017945797 6:159095495-159095517 CCCACTACCTGTGTGATGTTGTC No data
Right 1017945807 6:159095538-159095560 TGCTTTGCTTGTCAAAGAACAGG No data
1017945797_1017945809 28 Left 1017945797 6:159095495-159095517 CCCACTACCTGTGTGATGTTGTC No data
Right 1017945809 6:159095546-159095568 TTGTCAAAGAACAGGGAAGAAGG No data
1017945797_1017945808 21 Left 1017945797 6:159095495-159095517 CCCACTACCTGTGTGATGTTGTC No data
Right 1017945808 6:159095539-159095561 GCTTTGCTTGTCAAAGAACAGGG No data
1017945797_1017945803 -3 Left 1017945797 6:159095495-159095517 CCCACTACCTGTGTGATGTTGTC No data
Right 1017945803 6:159095515-159095537 GTCCCAGGGATTCAGCCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017945797 Original CRISPR GACAACATCACACAGGTAGT GGG (reversed) Intergenic
No off target data available for this crispr