ID: 1017945798

View in Genome Browser
Species Human (GRCh38)
Location 6:159095496-159095518
Sequence GGACAACATCACACAGGTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017945798_1017945802 -5 Left 1017945798 6:159095496-159095518 CCACTACCTGTGTGATGTTGTCC No data
Right 1017945802 6:159095514-159095536 TGTCCCAGGGATTCAGCCTCTGG No data
1017945798_1017945808 20 Left 1017945798 6:159095496-159095518 CCACTACCTGTGTGATGTTGTCC No data
Right 1017945808 6:159095539-159095561 GCTTTGCTTGTCAAAGAACAGGG No data
1017945798_1017945807 19 Left 1017945798 6:159095496-159095518 CCACTACCTGTGTGATGTTGTCC No data
Right 1017945807 6:159095538-159095560 TGCTTTGCTTGTCAAAGAACAGG No data
1017945798_1017945803 -4 Left 1017945798 6:159095496-159095518 CCACTACCTGTGTGATGTTGTCC No data
Right 1017945803 6:159095515-159095537 GTCCCAGGGATTCAGCCTCTGGG No data
1017945798_1017945809 27 Left 1017945798 6:159095496-159095518 CCACTACCTGTGTGATGTTGTCC No data
Right 1017945809 6:159095546-159095568 TTGTCAAAGAACAGGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017945798 Original CRISPR GGACAACATCACACAGGTAG TGG (reversed) Intergenic
No off target data available for this crispr