ID: 1017945801

View in Genome Browser
Species Human (GRCh38)
Location 6:159095502-159095524
Sequence TCCCTGGGACAACATCACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017945801_1017945808 14 Left 1017945801 6:159095502-159095524 CCTGTGTGATGTTGTCCCAGGGA No data
Right 1017945808 6:159095539-159095561 GCTTTGCTTGTCAAAGAACAGGG No data
1017945801_1017945809 21 Left 1017945801 6:159095502-159095524 CCTGTGTGATGTTGTCCCAGGGA No data
Right 1017945809 6:159095546-159095568 TTGTCAAAGAACAGGGAAGAAGG No data
1017945801_1017945807 13 Left 1017945801 6:159095502-159095524 CCTGTGTGATGTTGTCCCAGGGA No data
Right 1017945807 6:159095538-159095560 TGCTTTGCTTGTCAAAGAACAGG No data
1017945801_1017945810 25 Left 1017945801 6:159095502-159095524 CCTGTGTGATGTTGTCCCAGGGA No data
Right 1017945810 6:159095550-159095572 CAAAGAACAGGGAAGAAGGACGG No data
1017945801_1017945803 -10 Left 1017945801 6:159095502-159095524 CCTGTGTGATGTTGTCCCAGGGA No data
Right 1017945803 6:159095515-159095537 GTCCCAGGGATTCAGCCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017945801 Original CRISPR TCCCTGGGACAACATCACAC AGG (reversed) Intergenic
No off target data available for this crispr