ID: 1017945805

View in Genome Browser
Species Human (GRCh38)
Location 6:159095518-159095540
Sequence GCACCCAGAGGCTGAATCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017945805_1017945807 -3 Left 1017945805 6:159095518-159095540 CCAGGGATTCAGCCTCTGGGTGC No data
Right 1017945807 6:159095538-159095560 TGCTTTGCTTGTCAAAGAACAGG No data
1017945805_1017945809 5 Left 1017945805 6:159095518-159095540 CCAGGGATTCAGCCTCTGGGTGC No data
Right 1017945809 6:159095546-159095568 TTGTCAAAGAACAGGGAAGAAGG No data
1017945805_1017945808 -2 Left 1017945805 6:159095518-159095540 CCAGGGATTCAGCCTCTGGGTGC No data
Right 1017945808 6:159095539-159095561 GCTTTGCTTGTCAAAGAACAGGG No data
1017945805_1017945810 9 Left 1017945805 6:159095518-159095540 CCAGGGATTCAGCCTCTGGGTGC No data
Right 1017945810 6:159095550-159095572 CAAAGAACAGGGAAGAAGGACGG No data
1017945805_1017945811 30 Left 1017945805 6:159095518-159095540 CCAGGGATTCAGCCTCTGGGTGC No data
Right 1017945811 6:159095571-159095593 GGAGCCACCTAAGCCTGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017945805 Original CRISPR GCACCCAGAGGCTGAATCCC TGG (reversed) Intergenic
No off target data available for this crispr