ID: 1017945806

View in Genome Browser
Species Human (GRCh38)
Location 6:159095530-159095552
Sequence TTGACAAGCAAAGCACCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017945806_1017945811 18 Left 1017945806 6:159095530-159095552 CCTCTGGGTGCTTTGCTTGTCAA No data
Right 1017945811 6:159095571-159095593 GGAGCCACCTAAGCCTGTGCAGG No data
1017945806_1017945809 -7 Left 1017945806 6:159095530-159095552 CCTCTGGGTGCTTTGCTTGTCAA No data
Right 1017945809 6:159095546-159095568 TTGTCAAAGAACAGGGAAGAAGG No data
1017945806_1017945810 -3 Left 1017945806 6:159095530-159095552 CCTCTGGGTGCTTTGCTTGTCAA No data
Right 1017945810 6:159095550-159095572 CAAAGAACAGGGAAGAAGGACGG No data
1017945806_1017945813 22 Left 1017945806 6:159095530-159095552 CCTCTGGGTGCTTTGCTTGTCAA No data
Right 1017945813 6:159095575-159095597 CCACCTAAGCCTGTGCAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017945806 Original CRISPR TTGACAAGCAAAGCACCCAG AGG (reversed) Intergenic
No off target data available for this crispr