ID: 1017945809

View in Genome Browser
Species Human (GRCh38)
Location 6:159095546-159095568
Sequence TTGTCAAAGAACAGGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017945798_1017945809 27 Left 1017945798 6:159095496-159095518 CCACTACCTGTGTGATGTTGTCC No data
Right 1017945809 6:159095546-159095568 TTGTCAAAGAACAGGGAAGAAGG No data
1017945804_1017945809 6 Left 1017945804 6:159095517-159095539 CCCAGGGATTCAGCCTCTGGGTG No data
Right 1017945809 6:159095546-159095568 TTGTCAAAGAACAGGGAAGAAGG No data
1017945805_1017945809 5 Left 1017945805 6:159095518-159095540 CCAGGGATTCAGCCTCTGGGTGC No data
Right 1017945809 6:159095546-159095568 TTGTCAAAGAACAGGGAAGAAGG No data
1017945797_1017945809 28 Left 1017945797 6:159095495-159095517 CCCACTACCTGTGTGATGTTGTC No data
Right 1017945809 6:159095546-159095568 TTGTCAAAGAACAGGGAAGAAGG No data
1017945801_1017945809 21 Left 1017945801 6:159095502-159095524 CCTGTGTGATGTTGTCCCAGGGA No data
Right 1017945809 6:159095546-159095568 TTGTCAAAGAACAGGGAAGAAGG No data
1017945806_1017945809 -7 Left 1017945806 6:159095530-159095552 CCTCTGGGTGCTTTGCTTGTCAA No data
Right 1017945809 6:159095546-159095568 TTGTCAAAGAACAGGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017945809 Original CRISPR TTGTCAAAGAACAGGGAAGA AGG Intergenic
No off target data available for this crispr