ID: 1017948132

View in Genome Browser
Species Human (GRCh38)
Location 6:159113230-159113252
Sequence CTCTAACCGTAGAGGATCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017948128_1017948132 -5 Left 1017948128 6:159113212-159113234 CCCAGACCAGATGCTCAGCTCTA No data
Right 1017948132 6:159113230-159113252 CTCTAACCGTAGAGGATCCACGG No data
1017948129_1017948132 -6 Left 1017948129 6:159113213-159113235 CCAGACCAGATGCTCAGCTCTAA No data
Right 1017948132 6:159113230-159113252 CTCTAACCGTAGAGGATCCACGG No data
1017948126_1017948132 14 Left 1017948126 6:159113193-159113215 CCTGTCCTGTGGGTTAATGCCCA No data
Right 1017948132 6:159113230-159113252 CTCTAACCGTAGAGGATCCACGG No data
1017948127_1017948132 9 Left 1017948127 6:159113198-159113220 CCTGTGGGTTAATGCCCAGACCA No data
Right 1017948132 6:159113230-159113252 CTCTAACCGTAGAGGATCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017948132 Original CRISPR CTCTAACCGTAGAGGATCCA CGG Intergenic
No off target data available for this crispr