ID: 1017950382

View in Genome Browser
Species Human (GRCh38)
Location 6:159130756-159130778
Sequence GTCCCAGGTGGTGCTGACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017950382_1017950387 -2 Left 1017950382 6:159130756-159130778 CCCAGGTCAGCACCACCTGGGAC No data
Right 1017950387 6:159130777-159130799 ACCTGGTGAAGAACGCACCCTGG No data
1017950382_1017950392 19 Left 1017950382 6:159130756-159130778 CCCAGGTCAGCACCACCTGGGAC No data
Right 1017950392 6:159130798-159130820 GGCAGGCCTCGCCCCAGACCCGG No data
1017950382_1017950393 20 Left 1017950382 6:159130756-159130778 CCCAGGTCAGCACCACCTGGGAC No data
Right 1017950393 6:159130799-159130821 GCAGGCCTCGCCCCAGACCCGGG No data
1017950382_1017950389 2 Left 1017950382 6:159130756-159130778 CCCAGGTCAGCACCACCTGGGAC No data
Right 1017950389 6:159130781-159130803 GGTGAAGAACGCACCCTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017950382 Original CRISPR GTCCCAGGTGGTGCTGACCT GGG (reversed) Intergenic