ID: 1017953966

View in Genome Browser
Species Human (GRCh38)
Location 6:159162664-159162686
Sequence TCTTCTATGGAGAAGGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017953955_1017953966 23 Left 1017953955 6:159162618-159162640 CCGCAAGACTGAAAGGGCAGCGT No data
Right 1017953966 6:159162664-159162686 TCTTCTATGGAGAAGGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017953966 Original CRISPR TCTTCTATGGAGAAGGGGGA AGG Intergenic
No off target data available for this crispr