ID: 1017958300

View in Genome Browser
Species Human (GRCh38)
Location 6:159198562-159198584
Sequence CAGCTGGACTTGGGGAGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 397
Summary {0: 1, 1: 2, 2: 3, 3: 36, 4: 355}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017958300_1017958304 -10 Left 1017958300 6:159198562-159198584 CCTTGGCTCCCCAAGTCCAGCTG 0: 1
1: 2
2: 3
3: 36
4: 355
Right 1017958304 6:159198575-159198597 AGTCCAGCTGTGAAGTTAAATGG 0: 1
1: 0
2: 2
3: 18
4: 198
1017958300_1017958306 10 Left 1017958300 6:159198562-159198584 CCTTGGCTCCCCAAGTCCAGCTG 0: 1
1: 2
2: 3
3: 36
4: 355
Right 1017958306 6:159198595-159198617 TGGAGATTCTATCAGATCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017958300 Original CRISPR CAGCTGGACTTGGGGAGCCA AGG (reversed) Intronic
900174302 1:1285042-1285064 CAGATGGCCTTGGGGACGCAGGG + Intronic
900431354 1:2604581-2604603 GTGCTGGGCTTGGGGTGCCAGGG + Intronic
901127264 1:6938408-6938430 CAGCAGGAGGTGGGGAGCAAAGG + Intronic
901917021 1:12507747-12507769 CAGCTGACCTTGAGGAGCCGGGG + Intronic
902188889 1:14746623-14746645 AAGCTGGAGTTGGGGAGCTGGGG + Intronic
903142080 1:21345021-21345043 CAGCTTGGCTTGGAGACCCAGGG - Intronic
903957280 1:27034083-27034105 CAGCTGGACTTGTGGGGGCGGGG + Intergenic
904285212 1:29449607-29449629 CAGCTGACCTGGGGGAGCCCCGG - Intergenic
904300773 1:29551996-29552018 GAGCTGGGCTTGGGGACACAGGG + Intergenic
904457430 1:30656047-30656069 GAGCTGGGCTTGGGGACACAGGG - Intergenic
904536340 1:31201993-31202015 CCGCTGGGCCTGGGGAGCCAGGG + Intronic
904567403 1:31435874-31435896 CTGCTGGTAGTGGGGAGCCATGG + Intergenic
906606328 1:47174907-47174929 CAGCTGGGCTGGGTGAGCCCAGG - Intergenic
906675317 1:47688910-47688932 CAGATGGGCTTTGGGAGCCAGGG - Intergenic
907499063 1:54865259-54865281 CAGCTGGCCTGGAGGAGCCAGGG + Intronic
907917129 1:58881566-58881588 CAGCTGGACTGAGGGATCCCTGG + Intergenic
909761825 1:79298014-79298036 TAGCTGGGGTTGGGGAGTCATGG + Intergenic
912683969 1:111747550-111747572 ATTCTGGACATGGGGAGCCAAGG - Intronic
914255681 1:145960275-145960297 TAGGTGGGCCTGGGGAGCCAGGG - Exonic
914444165 1:147735671-147735693 CAGCTGTACTTGTGGTGACAGGG + Intergenic
916656215 1:166877622-166877644 CAGCAGAGCGTGGGGAGCCATGG - Intergenic
917515213 1:175701465-175701487 CAGCTGGGGTTGAGGAGCCAAGG - Intronic
919578207 1:199337603-199337625 CCACTGCACTGGGGGAGCCAAGG - Intergenic
920767861 1:208850757-208850779 CAGATGGACTTGCGCAGACATGG + Intergenic
921122907 1:212152254-212152276 CAGCTGGAAATGGGAACCCATGG + Intergenic
921777029 1:219112675-219112697 CCACTGCACTTGGGGAGCTAAGG - Intergenic
922315552 1:224438668-224438690 CAGCTGGACTTGTTGGGCCTGGG + Intronic
923092444 1:230750717-230750739 CAGCTGTACTTGGGGAGGGTGGG + Intronic
923516713 1:234703809-234703831 CAGCTGGACTTGAGGGATCAGGG + Intergenic
923542333 1:234897502-234897524 CAGCTGGGGTTGGGGAGCATTGG - Intergenic
923622405 1:235589270-235589292 CAGGTAGACAGGGGGAGCCAGGG + Intronic
1063822475 10:9853793-9853815 CAGCTGGACTCCGGGAGATATGG - Intergenic
1064199702 10:13274108-13274130 TTGCTGGACTTGGGGAGGGAGGG + Intergenic
1065830203 10:29608356-29608378 CAGCTGCAGTGGGGAAGCCATGG + Intronic
1067429112 10:46231246-46231268 CAGCTGGAGTGGAGGAGGCAGGG + Intergenic
1067737979 10:48873557-48873579 GAGCTGGGCTTGTGGAGCCAGGG + Exonic
1069854693 10:71433561-71433583 CAGCTGGACATGCTCAGCCAAGG - Intronic
1071951640 10:90709915-90709937 CACCAGGACCTGAGGAGCCATGG + Intergenic
1072726505 10:97817158-97817180 CAGCTGGGGTTGAGAAGCCATGG - Intergenic
1073139372 10:101237318-101237340 CCGCAGGACTGGCGGAGCCAGGG - Intergenic
1073460123 10:103661323-103661345 CCGGGGGACATGGGGAGCCAGGG + Intronic
1073559561 10:104485321-104485343 AACCCAGACTTGGGGAGCCAGGG - Intergenic
1074219713 10:111424568-111424590 CAGCTGGAAGTGAGGGGCCATGG - Intergenic
1074721880 10:116271646-116271668 CAGGTGGAGTTGGGGAGCATTGG - Intronic
1076822256 10:132945330-132945352 TAGGTGGAGTTGGGGAGGCACGG + Intergenic
1077416516 11:2426618-2426640 GAGCTGGTCTTGGGGAGCCCAGG - Intergenic
1077849970 11:6066807-6066829 CAGCTGGACTTCAGGGTCCAGGG - Intergenic
1078539216 11:12199949-12199971 CACCCAGACTTGGGGAGCCAGGG - Intronic
1080640231 11:34154393-34154415 GAGCAGGTCTTGGGGACCCATGG + Intronic
1081001691 11:37681001-37681023 CAGCTGGACGTTGGAAACCACGG + Intergenic
1082001435 11:47395432-47395454 CACCTTGCCTTGGGGAGGCATGG + Intergenic
1084063474 11:66690275-66690297 CTGCTGGACCTGCGGAGCCCCGG + Exonic
1084117827 11:67052269-67052291 CTGCTGGCAGTGGGGAGCCATGG + Intergenic
1084548870 11:69828897-69828919 CAGTGGGGCTGGGGGAGCCATGG - Intergenic
1084946177 11:72639786-72639808 CAGCTGGGGTTGGGGGGGCATGG + Intronic
1086436312 11:86784359-86784381 CAGCTGGATTTGTGAAGCCCAGG - Intergenic
1086554622 11:88094292-88094314 CAGATGGACTTGGAGAGTGATGG - Intergenic
1087222808 11:95564735-95564757 CACCTGTATTTGGGAAGCCAAGG + Intergenic
1089109780 11:116046242-116046264 CAGCTCGCCTTGGGGAGACGTGG + Intergenic
1089541836 11:119193836-119193858 CAGCTGGTCTTCGGAAGCCTTGG + Exonic
1089580224 11:119476967-119476989 CAGCTGGACCTGGACAGCCAGGG + Intergenic
1089863660 11:121612902-121612924 GAGCTTGACTGGGGGTGCCAGGG + Intronic
1090116655 11:123980175-123980197 CCTCTGGACTTTGGGTGCCAAGG - Intergenic
1090910257 11:131111978-131112000 CAGCTGCAGTGGGGGAGGCACGG - Intergenic
1091037352 11:132245874-132245896 CAGAGAGACTCGGGGAGCCAAGG + Intronic
1091132683 11:133159746-133159768 CAGCTGGGCTTTGGGAGACAGGG - Intronic
1091158112 11:133392777-133392799 CAACTGTACTTCAGGAGCCATGG - Intronic
1091439035 12:498306-498328 CAACTGGACTTGGGCGGACATGG - Intronic
1094414374 12:30201797-30201819 CAGCTGGAGTGGGAGAGGCAGGG - Intergenic
1095318020 12:40790265-40790287 CAGATGAACTTCAGGAGCCAGGG + Intronic
1095743598 12:45633394-45633416 CATCTGGACTAGAGAAGCCAAGG + Intergenic
1095981556 12:47977355-47977377 CAGCGGGGCCAGGGGAGCCAGGG + Exonic
1096524765 12:52203876-52203898 CAGCTGACCTTGGGGAGCGAGGG + Intergenic
1097748207 12:63323223-63323245 CTGTAGGACTTGGGGAGCAAAGG + Intergenic
1098362895 12:69672443-69672465 CAGCTGGACACTGGGAGCCTGGG - Intronic
1100387662 12:94118730-94118752 AAGCTGGACTATGGGAGCCCTGG - Intergenic
1101041875 12:100763614-100763636 CAGCAGGACTGGGGGAGATAAGG - Intronic
1101578372 12:106018956-106018978 CAGCTGCACTTGGGGTCCCCAGG - Intergenic
1102784217 12:115591134-115591156 CAGCTGGACTTGTGGGGCATAGG - Intergenic
1102922687 12:116803999-116804021 AAGTGGGACTTGGGGAACCATGG + Intronic
1103701110 12:122849166-122849188 CAGCAGGTCTGGGGGAGCCCAGG - Intronic
1104936394 12:132366572-132366594 AATCTGGCCTTGGTGAGCCAGGG + Intergenic
1106103249 13:26712339-26712361 CAGAAGGACATGGGGAGGCAGGG - Intergenic
1107486790 13:40835501-40835523 TAACTGGATTTAGGGAGCCAAGG + Intergenic
1107905093 13:45054311-45054333 CTGCTGGACTTAAGGAGCAAAGG + Intergenic
1108037762 13:46309423-46309445 GAACAGGACTTGGGGAGACAGGG - Intergenic
1108323767 13:49310177-49310199 CACCTGGACTGCGGGAGGCATGG + Exonic
1108660432 13:52580517-52580539 TAACTGGATTTAGGGAGCCAAGG - Intergenic
1109368656 13:61392528-61392550 CAGCAGGACTTGAGGAGGTAAGG - Intergenic
1111002572 13:82205167-82205189 CAGCTGTGCTTGGGAAGGCAGGG - Intergenic
1113297334 13:108973559-108973581 CAGTCGGACTTGGGGACACAGGG - Intronic
1113454731 13:110440147-110440169 CTCCTGGACTTGGTGACCCAGGG + Intronic
1113693232 13:112326639-112326661 CAGCGGGGCCTGGGGAGGCAGGG + Intergenic
1113916241 13:113875662-113875684 CAGCAGGACACCGGGAGCCAGGG + Intergenic
1114422790 14:22598508-22598530 CGGCTGAGCCTGGGGAGCCATGG + Intronic
1116769877 14:49114842-49114864 CAGCTGGACTTTGAGAGCAATGG - Intergenic
1121201447 14:92121622-92121644 CAGGTGGGTTTGGGGAGCCCGGG - Exonic
1121409487 14:93739655-93739677 CAGCTGGATTAGGAGATCCAGGG + Intronic
1124366160 15:29072810-29072832 CAGCAGGACTGGGGGAGGCAGGG + Intronic
1124632959 15:31347639-31347661 CAGTGTGACTTGGGAAGCCAAGG + Intronic
1125970014 15:43903981-43904003 CAGAGTGACTTGAGGAGCCATGG + Intronic
1127466434 15:59249012-59249034 CAGCTGGAGTTGAGCAGCCTTGG - Intronic
1127906374 15:63379429-63379451 CAGCTAGAAGTGGGGAACCAGGG - Intronic
1128082956 15:64867110-64867132 TGGCTGGACCTCGGGAGCCAGGG - Exonic
1128743325 15:70097532-70097554 CCGCTGGACTTAGGATGCCAGGG - Exonic
1131500179 15:92955777-92955799 CAACTGGACTTGGTGACCTAAGG - Intronic
1132029160 15:98426577-98426599 CATCTGGTCCTTGGGAGCCAAGG + Intergenic
1132089760 15:98938570-98938592 CAGCTGGACTTCAGTTGCCAAGG + Intronic
1132580116 16:680788-680810 CGGCTGGGCTTTGGGAGCCGAGG - Intronic
1132728145 16:1347657-1347679 CAGCTGGGCTCTGGGAGCCTCGG - Intronic
1132761659 16:1511393-1511415 CAGCTGGAAATGCAGAGCCAGGG + Intronic
1132883669 16:2173069-2173091 CAGCTGGACCTGGGGTGCAGCGG + Intronic
1133219692 16:4314810-4314832 CAGTTGGCCTTGAGGAGCCTAGG - Exonic
1133776839 16:8903216-8903238 AAGGTGGACGTTGGGAGCCACGG + Intronic
1134624001 16:15711048-15711070 CTGCTGTACTTTGGGAGCCTAGG + Intronic
1135240883 16:20806441-20806463 CAGCTGGACTTGGAAAAGCAAGG - Exonic
1135875262 16:26193326-26193348 CAGCTGCACTTGGCCAGTCAGGG - Intergenic
1136043212 16:27596459-27596481 CAGCTGGAGATGGGAATCCAGGG + Intronic
1136104354 16:28018860-28018882 CAGCTGGGCTTGGGGATCAAAGG - Intronic
1136270775 16:29147001-29147023 CAGGTGGTCTTGGGGAGTGAGGG - Intergenic
1136279408 16:29199171-29199193 GAGCTGGGCATTGGGAGCCAGGG - Intergenic
1137588491 16:49679235-49679257 CAGCTGCAGTTGGGGAGGCATGG + Intronic
1138081427 16:54094604-54094626 CAGGTGGACTTGGGAATCCAGGG + Intronic
1140356435 16:74310862-74310884 CACCTGGCCTTGGGAGGCCAAGG + Intergenic
1140375372 16:74441259-74441281 CTGCTGGACATGGTGAGACATGG + Intergenic
1141205951 16:81933299-81933321 GAGCTGGTGTTGGGGAGCAAAGG + Intronic
1141555397 16:84833848-84833870 CTGCTGGGCTGGGGGAGTCAGGG - Intronic
1142083798 16:88165272-88165294 GAGCTGGGCATTGGGAGCCAGGG - Intergenic
1142192733 16:88725386-88725408 CAGCTGGAGTCGGGCACCCAGGG - Intronic
1142225774 16:88877002-88877024 CAGGTGGGCTGGGGGAGCCGGGG + Exonic
1142275475 16:89116486-89116508 TTGCTGGGCCTGGGGAGCCATGG + Intronic
1142361688 16:89630602-89630624 GAGCGGGGCTGGGGGAGCCAGGG + Intronic
1142576847 17:914790-914812 GAGCTGGATGTGGGGAACCAGGG + Intronic
1142746772 17:1963315-1963337 CAGCTGGACTCCCAGAGCCACGG - Intronic
1143259138 17:5585068-5585090 AAGCAGGCCTCGGGGAGCCAGGG + Intronic
1144406678 17:14958716-14958738 CAGGTGGACTTTGGGAGACCAGG - Intergenic
1144649709 17:16999741-16999763 CTGCTGGGCTCTGGGAGCCATGG - Intergenic
1144726529 17:17505195-17505217 CAGCTAGACTGGGGTGGCCAAGG + Intergenic
1144837511 17:18164440-18164462 TAGCTGGACTTGGGCAGGCAGGG - Intronic
1146289801 17:31598980-31599002 CAGCTGAACTTGGGGAGGTGGGG + Intergenic
1146379671 17:32319522-32319544 ACCCTGGACCTGGGGAGCCAAGG + Intronic
1146843055 17:36168027-36168049 CAGCGGGGCCTGGGGAGCCCTGG - Intronic
1146855360 17:36255968-36255990 CAGCGGGGCCTGGGGAGCCCTGG - Intronic
1146865261 17:36332407-36332429 CAGCGGGGCCTGGGGAGCCCTGG + Intronic
1146871266 17:36379879-36379901 CAGCGGGGCCTGGGGAGCCCTGG - Intronic
1146878626 17:36430961-36430983 CAGCGGGGCCTGGGGAGCCCTGG - Intronic
1146882574 17:36452107-36452129 CAGCGGGGCCTGGGGAGCCCTGG - Intergenic
1147068121 17:37933001-37933023 CAGCGGGGCCTGGGGAGCCCTGG + Intronic
1147074152 17:37980503-37980525 CAGCGGGGCCTGGGGAGCCCTGG - Intronic
1147079651 17:38012556-38012578 CAGCGGGGCCTGGGGAGCCCTGG + Intronic
1147085674 17:38060041-38060063 CAGCGGGGCCTGGGGAGCCCTGG - Intronic
1147095592 17:38136498-38136520 CAGCGGGGCCTGGGGAGCCCTGG + Intergenic
1147101621 17:38184007-38184029 CAGCGGGGCCTGGGGAGCCCTGG - Intergenic
1148083631 17:44980949-44980971 AAGCTGGACTTGGGGAGAATGGG + Intergenic
1149846219 17:60010513-60010535 CAGCGGGGCCTGGGGAGCCCTGG - Intergenic
1150084568 17:62267093-62267115 CAGCGGGGCCTGGGGAGCCCTGG - Intergenic
1150230265 17:63545843-63545865 CAGCTGGACTTCCAGAGACATGG + Exonic
1150653718 17:67025873-67025895 CAGCCGCCATTGGGGAGCCAAGG + Intronic
1150751579 17:67868416-67868438 CTGCAGGACTTGGGCATCCATGG - Intronic
1151231521 17:72688562-72688584 CTGTTAAACTTGGGGAGCCATGG - Intronic
1151772035 17:76170017-76170039 CAGCAGGACTTGGGGATCCTGGG + Intronic
1152008332 17:77696026-77696048 GAGCTGCACTAGGGGAGCCCAGG - Intergenic
1152688442 17:81706588-81706610 CAGCTGGACTCGCGAGGCCAAGG + Intronic
1152920356 17:83063457-83063479 CAGCAGGACTTTAGGGGCCAGGG - Intergenic
1154048192 18:10927422-10927444 CCGATGGCCTGGGGGAGCCAAGG - Intronic
1155074339 18:22341799-22341821 CACCTGGACTTGGTGGGCCAGGG + Intergenic
1155622377 18:27794626-27794648 GGGGTGGACTTGGGGAGACAAGG - Intergenic
1156419309 18:36933668-36933690 CAGCTGTTCTAGGGGATCCAGGG + Intronic
1156435618 18:37125234-37125256 CAGCTGAACCTGGGAAGTCAAGG + Intronic
1157442081 18:47719100-47719122 CAGCAGGACCTGGGGACACAGGG + Intergenic
1157506617 18:48231002-48231024 CCTCTGGACTTTGGGTGCCAAGG + Intronic
1158534512 18:58295769-58295791 CAGCTGCACTTTGGCACCCAGGG + Intronic
1158898698 18:61940687-61940709 CAGCTGGACTTTGTGGGGCAGGG - Intergenic
1159609928 18:70513763-70513785 CAGACGGACGGGGGGAGCCAGGG - Intergenic
1160200519 18:76792120-76792142 GAAGTGCACTTGGGGAGCCACGG + Intergenic
1160702924 19:517319-517341 CAGTTGGAGCTGGGAAGCCAGGG + Intronic
1161201801 19:3019335-3019357 CAGCTGAGCCTGGGCAGCCAGGG + Exonic
1161805570 19:6441346-6441368 CAGCTGAGCTTGGAGATCCAGGG + Exonic
1161870180 19:6863870-6863892 CTGCAGGATTTGGGGAGCCGTGG + Intergenic
1161980281 19:7626658-7626680 AGGCTGGACTAGTGGAGCCAAGG - Intronic
1161994177 19:7702399-7702421 CAGAGGGCCCTGGGGAGCCACGG + Intergenic
1163106151 19:15124151-15124173 CAGCTGGAGTTGGGAGGCCTCGG - Intronic
1165101499 19:33441196-33441218 CAGGAGGCCTTGGAGAGCCAGGG - Intronic
1166002241 19:39884750-39884772 CAACTTGACCTGGGGAGTCAGGG + Intronic
1166005025 19:39901001-39901023 CAACTTGACCTGGGGAGTCAGGG + Intronic
1166299402 19:41905668-41905690 GAGCTGGAGGTGGGGAGGCAGGG - Intronic
1167122122 19:47523762-47523784 CAGCAGGACTTAGGGAGCTGAGG + Intronic
1167245550 19:48371034-48371056 GAGCCGGACTTGGGGAGCCATGG - Intronic
1167420014 19:49397315-49397337 CTGCTGGACTGGGGGTGACAGGG + Intronic
1167698291 19:51027425-51027447 CAGCTGGACTCGGGCTGCCTGGG - Intronic
1167749367 19:51370669-51370691 GAGCAGGACTTAGGGACCCAAGG - Intergenic
1168580577 19:57552592-57552614 CAGCTGGTCATGTGGAGTCATGG - Intronic
927089198 2:19697755-19697777 CAGTGGGACTTGGGGATCCCGGG - Intergenic
927156388 2:20223938-20223960 CAGCTGCACTGGGCGGGCCAAGG + Intronic
928279731 2:29935162-29935184 CACCAGGTCTTGGGGAGCCTGGG - Intergenic
929795569 2:45055985-45056007 CAGCTGAAAATGGGGAGGCAGGG + Intergenic
929881643 2:45842031-45842053 CAGGGGGACTTGGTGATCCAGGG + Intronic
931691354 2:64837270-64837292 GAGCTGGCCCTGGGGAGCCCTGG - Intergenic
932082913 2:68731775-68731797 TAACTGGACTTGGGGAGTGAAGG - Intronic
933340001 2:81011949-81011971 AAGCTGGAACTGTGGAGCCAAGG - Intergenic
936067988 2:109346616-109346638 CAGATGGACTTGATGAGACAGGG + Intronic
936376015 2:111942107-111942129 CAGCTGGACTCAGGGAGACAGGG - Intronic
937953898 2:127408466-127408488 CAGCAGGACTGGGAGAGCCGCGG - Intergenic
940422954 2:153500011-153500033 CAGCTGCAGTGGGGGAGGCATGG - Intergenic
940646841 2:156400514-156400536 CTGCTGGACGTCGGGAGCCTGGG - Intergenic
943049104 2:182894244-182894266 CAGCTGGACTAGGTGTGCCATGG - Intergenic
946948406 2:224846335-224846357 CAGCCGCACTTTGGGAGGCACGG - Intronic
947324935 2:228963587-228963609 CATCTGGTCCTTGGGAGCCAGGG + Intronic
947551663 2:231050902-231050924 CAGCTGGGGCTGGGGAGCCCAGG - Intergenic
948351742 2:237346502-237346524 CAGCTGGTCCTGGGTAGCCAGGG + Exonic
948716313 2:239865622-239865644 CAGCTGGACTCGGGCAGGGAGGG + Intergenic
948808552 2:240463333-240463355 CAGGGGGACCTGGGGAGCAAGGG - Exonic
948895784 2:240926272-240926294 CAGGGGGACCTGGGGGGCCACGG - Intronic
1169112381 20:3042636-3042658 CACCTGGACTTCAGCAGCCAAGG - Intergenic
1172010293 20:31842512-31842534 CGGCTGGGCTGGGGGAGCCCAGG - Intergenic
1172013780 20:31861367-31861389 CAGTCGGAAGTGGGGAGCCACGG + Exonic
1172793433 20:37521518-37521540 CAGCGGCACTTGGGCAGGCAAGG - Intronic
1173569233 20:44066055-44066077 CAGCTGCACCTGGAGTGCCATGG - Exonic
1174702132 20:52619903-52619925 CAGCAGGACCTGGTGGGCCATGG - Intergenic
1174991152 20:55511423-55511445 TATGTGGACTTGGGGAACCATGG - Intergenic
1175227279 20:57451932-57451954 CAGCAGGACTCGGGGTGCCTGGG - Intergenic
1175258975 20:57663212-57663234 TGGCTAGACTTGGTGAGCCAAGG + Intronic
1175936930 20:62518251-62518273 CAGCTGTACTTGGGGAGCCATGG + Intergenic
1175963838 20:62650300-62650322 CAGCTGGGCTTGGGGAAGAAGGG - Intronic
1176244105 20:64089251-64089273 CACCTGGACTGGGGAGGCCACGG + Intronic
1176973418 21:15290754-15290776 CAGCTGCACTCGGGGAGGCGTGG - Intergenic
1178335140 21:31735790-31735812 CAGCTAGACTTTGGGTGCCTTGG + Intergenic
1179710794 21:43211889-43211911 CAGCTGGCCTTGGGGAGCTGGGG + Intergenic
1179907978 21:44434032-44434054 CAGCTGTCCTGGGGCAGCCACGG + Intronic
1179908718 21:44437024-44437046 CAGCGGGTCCTGGGCAGCCATGG + Intronic
1180048308 21:45319856-45319878 CAGCTGGACGTGGGGCCACACGG + Intergenic
1180984514 22:19896626-19896648 TAGCTGGACTTGGGGCGCACAGG - Intronic
1181491352 22:23262643-23262665 CAGCTGCTCTTGGGCAGCCAGGG + Intronic
1181670302 22:24422761-24422783 CCTCAGGACCTGGGGAGCCATGG + Intronic
1182149086 22:28016130-28016152 CAGCAGGACTTGGAGGGCCAGGG + Intronic
1182755208 22:32673599-32673621 CATCAGGACTTGAAGAGCCAGGG + Intronic
1183059561 22:35327832-35327854 CCACTGATCTTGGGGAGCCAAGG + Intronic
1183304958 22:37077927-37077949 CTGCTGGGCTGGGGGAACCATGG - Intronic
1183305317 22:37079965-37079987 CAGCTGGCCTAGGGAACCCATGG + Intronic
1183654082 22:39175090-39175112 CAGCCAGACTTGGGGGGCTAGGG + Intergenic
1183948443 22:41339733-41339755 CATCAGGACTTGGGGAAGCAAGG - Intronic
1184326264 22:43789350-43789372 CAGCAGCACTGGGTGAGCCAAGG + Intronic
1184785408 22:46669180-46669202 TAGCAGGACTTGGGGTGTCAGGG + Intronic
949467047 3:4354735-4354757 CAGATGGTCCTGGGCAGCCATGG - Intronic
949881002 3:8660611-8660633 CAGCTGTACTTAAGAAGCCAGGG - Intronic
950989627 3:17418997-17419019 CTGCTGGACTTTGGTATCCATGG + Intronic
952282566 3:31937888-31937910 CTGCTGGACTTGGTGACTCAGGG - Intronic
952446136 3:33382868-33382890 CAGATGGAATTGGGGAGGTAAGG - Intronic
952595173 3:35008855-35008877 CAGATGGACTTAGTGAGCAAAGG - Intergenic
953373174 3:42407033-42407055 CAGCTGGAGTTGGGGATGCTTGG + Intronic
954581215 3:51703897-51703919 GAGCTGGACTTGGAGGGCGAGGG + Exonic
955733602 3:62013578-62013600 CAGCAGGGCTTGGGTAGCTATGG + Intronic
956972405 3:74541980-74542002 CACCAGCACTTGGGAAGCCAAGG + Intergenic
957613912 3:82505178-82505200 CAGCTGCAGTGGGGGAGGCAGGG + Intergenic
958584596 3:96069629-96069651 CAGCTGCAGTGGGGGAGGCATGG - Intergenic
958813704 3:98892637-98892659 CAGCTAGACTTCAGGAACCAAGG - Intronic
960148798 3:114231175-114231197 AAGCTGGACTGGGAGAACCAAGG + Intergenic
961626770 3:128269473-128269495 CACCGGGACATGGGGGGCCATGG + Intronic
962505769 3:136045265-136045287 CAGCTGTGCTGGGTGAGCCAAGG - Intronic
962600295 3:136986574-136986596 CAGGAGGACTTGGGAAGCCAGGG - Intronic
963883139 3:150550748-150550770 CACCTGGACTTGGGAAGTCAAGG - Intronic
964418139 3:156471607-156471629 CAGCTGCCCTTCTGGAGCCAAGG + Intronic
964661748 3:159127273-159127295 CAGAGGGAGTTGGGGAGGCAGGG + Intronic
966319473 3:178685085-178685107 CAGGTGGAGTTGGGTAGGCATGG - Intronic
967046266 3:185739937-185739959 CACCTGAACTTGGGAAGTCAGGG - Intronic
967818114 3:193815921-193815943 CACCTGGCCTTGGGCAGACAAGG - Intergenic
968622499 4:1610268-1610290 CAGCTGGAGTCTGGGGGCCAGGG - Intergenic
968701890 4:2061324-2061346 CAGCGGGGCTGGGGGAGGCACGG + Intronic
968971384 4:3797378-3797400 CAGCTGGACTTAGGAAATCAAGG - Intergenic
969039777 4:4287151-4287173 CAGAGGGAGTTGGGGAGCCAGGG - Intronic
969106508 4:4810771-4810793 CAGCTGGGATTGGGGATGCAAGG + Intergenic
969116396 4:4872986-4873008 CAGCCGGGCTGGGGGAGGCAGGG + Intergenic
969208491 4:5667529-5667551 CAGGTGGCCTTGGGGACCCTTGG - Intronic
969494141 4:7516281-7516303 CAGCTGGGCGTGGGGAGGGACGG + Intronic
970518580 4:16860158-16860180 CGGATGGATTTGGGTAGCCAGGG + Intronic
971201301 4:24511642-24511664 CAGCTGGGAGTGTGGAGCCAGGG + Intergenic
974000929 4:56509957-56509979 CAGATGAACTTGGGAGGCCAAGG - Intronic
975060057 4:69986002-69986024 CACCTGGGCTTTGGGAGTCATGG - Intergenic
977193010 4:94023714-94023736 CAGCTGGACATGGTGACACAAGG + Intergenic
977816292 4:101417066-101417088 CCTCTGGACTTAGGGTGCCAAGG - Intronic
979518789 4:121642273-121642295 CTGTGGGACTTGGGGAGCAAAGG - Intergenic
980082438 4:128358214-128358236 CAGATGACCTTGGAGAGCCAGGG + Intergenic
980387171 4:132101358-132101380 CTGCTGTACTTGGGGAGCTGAGG - Intergenic
980574488 4:134666933-134666955 CAGCTGCAGTTTGGGAGGCATGG - Intergenic
981255901 4:142660242-142660264 CACCAGGACTTGGGGATGCAAGG + Intronic
982766875 4:159358844-159358866 CAGAAGGACATGGGAAGCCAGGG - Exonic
982901159 4:161003921-161003943 CAGCTGCAGTGGGGGAGGCATGG - Intergenic
983069835 4:163254657-163254679 CAGCTGCAGTTGGGGAGGTATGG - Intergenic
983321585 4:166202398-166202420 CACCGGGACTTAGGGATCCAAGG + Intergenic
985621660 5:959305-959327 CAGATGGACTTGGGGGCCGATGG - Intergenic
986199711 5:5569982-5570004 CAGCTGTGCTTGGGGCCCCAGGG - Intergenic
986897374 5:12386241-12386263 CAGCTTGAGGTGGGGAGACAGGG - Intergenic
988158452 5:27486612-27486634 CAGCTGGGCTTGGGAAGCCAGGG - Intergenic
991507934 5:67343939-67343961 CACCTGGCCTTGCGGAGCCTGGG + Intergenic
992572828 5:78077359-78077381 CAGTTGGCCTTGGGGATTCATGG - Intronic
992965664 5:81997272-81997294 CTGCTGCACTGGAGGAGCCAAGG - Intronic
993121245 5:83776865-83776887 CAGAAGGACCTGAGGAGCCAGGG - Intergenic
993137790 5:83991649-83991671 CTGATGGCATTGGGGAGCCAGGG + Intronic
994753348 5:103764887-103764909 CAGCTGTAGTGGGGGAGGCATGG - Intergenic
995488074 5:112659091-112659113 CTGCTGCACTGGAGGAGCCAAGG - Intergenic
997319163 5:132963601-132963623 CAGCTGGACTCCTGCAGCCAGGG + Exonic
997355311 5:133259017-133259039 CTGCTGGACTGAGGGAGCAAGGG + Intronic
998742326 5:145218290-145218312 CAGCTGGAGTTGGGAAGGCTGGG - Intergenic
998953064 5:147411388-147411410 CAGCTGGGCTTGGGAGGCAAGGG + Intronic
1001251987 5:170153560-170153582 CTGCTGGATTTGGGGAATCAGGG - Intergenic
1001285265 5:170418471-170418493 CAGGAGGACTTGAGGAGGCAAGG - Intronic
1002372873 5:178768866-178768888 CCGCTGGACTTGGACAGCCATGG + Intergenic
1004214527 6:13689384-13689406 CACATCTACTTGGGGAGCCAAGG - Intronic
1005869807 6:29966339-29966361 CAGGAGGTCTTGGGGAGGCAAGG - Intergenic
1006088716 6:31615435-31615457 CAGCTGGCCTAGGGTAGCCCGGG + Intronic
1007634604 6:43291152-43291174 CAGCAGGACTTTGCGAGCCTGGG - Intergenic
1010669875 6:78674825-78674847 CACCAGGACTTGGGGATGCAAGG - Intergenic
1013224938 6:108114027-108114049 CAGGCGGGCTTGGGGAGCCGAGG + Intronic
1014505459 6:122248596-122248618 CAGCTGCAGTTGGGGAGGCGTGG - Intergenic
1015753338 6:136583598-136583620 GAGCTGGACTTCGACAGCCATGG - Exonic
1017499795 6:155013172-155013194 CAGCTGTACTACAGGAGCCATGG - Intronic
1017958300 6:159198562-159198584 CAGCTGGACTTGGGGAGCCAAGG - Intronic
1018058025 6:160069165-160069187 CAGCTGTACATGGGAAACCAAGG + Intronic
1018202758 6:161410650-161410672 CAGATGGAGTTGGGGAAACATGG + Intronic
1025790981 7:64686474-64686496 GAGCGGGACTTGGGGCGGCATGG - Intronic
1025951106 7:66146125-66146147 GAGATGGACTTGGGGAGCCAGGG - Intronic
1028857961 7:95613295-95613317 CCACTGTACTGGGGGAGCCAAGG - Intergenic
1030270195 7:107661672-107661694 CAGCTGTACTCGGGGAGCTGCGG - Exonic
1034492861 7:151403424-151403446 CAGCTGGTATTGGGTAGACAGGG + Intronic
1034502031 7:151456846-151456868 AAGCTGGAGCTGGGGTGCCAGGG + Intergenic
1035048487 7:155984438-155984460 CAGCTGGAGTGGGACAGCCAGGG - Intergenic
1035373698 7:158394500-158394522 CAGGTGGGCTTGGACAGCCACGG - Intronic
1037817130 8:22118241-22118263 CAGCTGGACTTGGGAACCACGGG + Intronic
1039507415 8:38061867-38061889 CAGATGGTCTTGGGGAGCTGGGG + Intergenic
1040404387 8:47086069-47086091 CAGCTGGGGTGGGGGGGCCAGGG + Intergenic
1041527373 8:58822516-58822538 CAGCTGGTTGTGTGGAGCCAGGG - Intronic
1041632431 8:60103250-60103272 CAGCTGGCCTGGGTGAGGCAGGG - Intergenic
1043195380 8:77286831-77286853 CAGCTGCAGTGGGGGAGGCATGG + Intergenic
1044053886 8:87543250-87543272 CAGCTGCAGATGGGGAGGCATGG - Intronic
1046068432 8:109222728-109222750 CACCAGGACTTGGGGATGCAAGG + Intergenic
1046503801 8:115111713-115111735 CCTCTGGACTTTGGGTGCCAAGG - Intergenic
1047251056 8:123182438-123182460 CAGCTGGGCTGGTGGTGCCAGGG + Exonic
1047497875 8:125421409-125421431 GAGCTGGACTTGGAGGGCCATGG - Intergenic
1047810689 8:128405577-128405599 AAGCTGGACTTCAGGAGCCTGGG + Intergenic
1047816082 8:128464549-128464571 CAGCTGCATTTGGAGAGGCAAGG - Intergenic
1048428515 8:134344787-134344809 CATCTGGACTTAGAGGGCCATGG + Intergenic
1049265817 8:141667377-141667399 CTGCTGGACATGGCGAGCCAGGG + Intergenic
1049432963 8:142573784-142573806 CAGCTGGAGGTTGGCAGCCAGGG + Intergenic
1049497335 8:142942422-142942444 CAGCTGGTCGAGGGGAGCCATGG - Intergenic
1049573057 8:143378546-143378568 CTGCTGGCCTTCGGGAGTCACGG + Intronic
1049756808 8:144314378-144314400 GGGCTGGTCTTGGGGAGGCAGGG + Exonic
1049858821 8:144883211-144883233 CAGCAGCACTTGGGCAGGCAGGG + Intronic
1052280065 9:26722703-26722725 CAACTGGACTTGTGATGCCAAGG - Intergenic
1052318364 9:27139953-27139975 TAGCGGGACTGGGGAAGCCAAGG - Intronic
1052437013 9:28443327-28443349 CAGCTGCAGGTGGGGAGGCATGG + Intronic
1052741392 9:32396018-32396040 CAACAGGACTTGGGGAACCAGGG - Intronic
1053053600 9:34980545-34980567 ACTCTGGACTTGGGGAGCAACGG - Exonic
1053128190 9:35599575-35599597 CAGTTGGTCCTGGGCAGCCATGG - Intergenic
1053218915 9:36295108-36295130 CAGCTAAACTTGGGAGGCCAAGG + Intronic
1053350797 9:37412113-37412135 CTGCTGGACTTGGCCAGACATGG + Intergenic
1053877405 9:42558372-42558394 CAGCTGCACTTGGGAGGGCAGGG + Intergenic
1054234290 9:62543350-62543372 CAGCTGCACTTGGGAGGGCAGGG - Intergenic
1055760386 9:79600736-79600758 GAGCCAGGCTTGGGGAGCCATGG - Intronic
1055797572 9:79992034-79992056 CAGCTGGGCTTGAGGATCCAAGG + Intergenic
1056738023 9:89226209-89226231 AAGGAGGACTTGGGGAGACAGGG - Intergenic
1056787811 9:89605330-89605352 TGGTTGGAGTTGGGGAGCCAAGG + Intronic
1058426908 9:104883291-104883313 GAGCTGGGTGTGGGGAGCCATGG - Intronic
1058529001 9:105887665-105887687 TAGCCTGACTTTGGGAGCCATGG + Intergenic
1059278093 9:113111922-113111944 CAGCTGGACATGGAGGGCCATGG + Intergenic
1059327746 9:113514614-113514636 CACCAGGACTTTGGGGGCCAGGG - Exonic
1060404923 9:123368407-123368429 GAGCAGGACTTGGGGAACCTCGG - Intronic
1060415337 9:123425924-123425946 CATCTGCACTGGGGGACCCAGGG - Intronic
1060630335 9:125152084-125152106 CAGTTGGGCTTGAGCAGCCATGG + Intronic
1060765896 9:126294884-126294906 TGGCTGGCCATGGGGAGCCATGG - Intergenic
1061357862 9:130119967-130119989 CAGCTGGACATGGTGACACATGG - Intronic
1061406050 9:130393627-130393649 CACCTGGCCTTGGGGGACCAGGG + Intronic
1061806365 9:133139718-133139740 CCGCTGCCCTTGGGGAGCCAGGG - Intronic
1061920397 9:133779385-133779407 GAGCTGGGCTGGGAGAGCCATGG - Intronic
1062295454 9:135822921-135822943 CAGCTGTCCTTGGGGAGACCGGG + Exonic
1203787859 EBV:137617-137639 CAGGTGGTCTTAGGGCGCCAGGG + Intergenic
1186789732 X:12985305-12985327 CAGCTGGACATGGGGAGGAAAGG - Intergenic
1187997797 X:24947349-24947371 CACCTGAACCTGGGGAGTCAAGG - Intronic
1191029952 X:55959045-55959067 CAGCTGCACTGGTGGGGCCAGGG - Intergenic
1192183344 X:68929824-68929846 CAGCTTGACTCCAGGAGCCAGGG + Intergenic
1192358939 X:70426357-70426379 CAGCAGCACCTGGGGGGCCAGGG - Exonic
1192537292 X:71939066-71939088 AAGCTGGACTTGGGGAGCCAAGG + Intergenic
1194236908 X:91396437-91396459 CTGCTGCAATTGAGGAGCCAAGG - Intergenic
1194891592 X:99385239-99385261 CAGCTGCAGTGGGGGAGGCATGG - Intergenic
1195740517 X:108060553-108060575 CAGCAGGATATGGGGAGTCAGGG - Intronic
1196641593 X:118068828-118068850 CAGCTGGACTTGAGGATATAGGG - Intronic
1197722401 X:129754452-129754474 CACCTGGAGTTGGGGAAGCAGGG - Exonic
1198217177 X:134566297-134566319 GAGCAGGGCTTGGTGAGCCATGG + Exonic
1200084017 X:153594119-153594141 CAGCTGTGCTTAGGAAGCCATGG - Intronic
1200397632 X:156000541-156000563 CAGCGGGACTGGGGGTGTCAGGG + Intronic
1200874786 Y:8142031-8142053 GAACTGGTCTTGTGGAGCCATGG + Intergenic
1202101767 Y:21316441-21316463 GAGCTGGCCTTGTGGAGGCATGG + Intergenic
1202187590 Y:22203406-22203428 GAACTGGCCTTGTGGAGCCATGG + Intergenic
1202198131 Y:22317367-22317389 CAGCTGGACTGCTTGAGCCACGG - Intronic
1202203770 Y:22382990-22383012 GAACTGGCCTTGTGGAGCCATGG - Intronic
1202259086 Y:22950761-22950783 CAGTGGGACTTGGGGATACAAGG - Intergenic
1202412072 Y:24584505-24584527 CAGTGGGACTTGGGGATACAAGG - Intergenic
1202458708 Y:25085563-25085585 CAGTGGGACTTGGGGATACAAGG + Intergenic