ID: 1017959351

View in Genome Browser
Species Human (GRCh38)
Location 6:159208289-159208311
Sequence GGCAACTGGTATTGGTCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 94}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017959351 Original CRISPR GGCAACTGGTATTGGTCTTC TGG Intronic
902831232 1:19014177-19014199 GGCAACTGGGATGGTTTTTCGGG + Intergenic
909725682 1:78832138-78832160 GGCAAGTAGTCTTGGTCTTTAGG - Intergenic
915213974 1:154328252-154328274 GACAACTGGTATGGGTCTGAGGG + Intronic
1064884706 10:20098160-20098182 GGACACTGGTTTTGGACTTCTGG - Intronic
1068636708 10:59356255-59356277 GCCAACCAGTATTGGTCTTGAGG - Intronic
1070190185 10:74105175-74105197 GGCAACCAGTATTGCTCGTCGGG + Exonic
1076635323 10:131878643-131878665 TGAAACTGGTTTTGGACTTCTGG - Intergenic
1078137996 11:8668472-8668494 GGCAACTGGTACTGGTTGTCAGG + Intronic
1079126356 11:17720831-17720853 GGCTACAGGAATTGGTGTTCGGG + Intronic
1081551669 11:44119235-44119257 AGTAACTGGAAGTGGTCTTCAGG - Intronic
1085003363 11:73061498-73061520 GCCAAGTGGTATGGGTCTGCGGG + Intronic
1085619339 11:78025931-78025953 GGCAACTGATTTTGGTCACCTGG - Intronic
1085648482 11:78244771-78244793 GGCATCTGTTATTTTTCTTCTGG - Intronic
1086537196 11:87862119-87862141 GTCAAATGGTATTTGTCTTTAGG - Intergenic
1086726624 11:90193494-90193516 GGCAGCTCGCATTTGTCTTCAGG - Intergenic
1088099206 11:106135994-106136016 GGCAGCTGTCAATGGTCTTCAGG + Intergenic
1090161313 11:124498575-124498597 GGCCAGTGGGATTAGTCTTCTGG - Intergenic
1093407446 12:18822190-18822212 GACAACTGATATAGGTATTCTGG - Intergenic
1102627488 12:114247039-114247061 GGCAACTGGCTTCAGTCTTCTGG + Intergenic
1103043945 12:117719625-117719647 GGCAACTGACATTTGGCTTCAGG - Intronic
1104203043 12:126610219-126610241 GGTAACTGGTATTGGACACCTGG - Intergenic
1108959924 13:56214191-56214213 GGGCACTGGTCTTGGTCTCCTGG + Intergenic
1111635925 13:90903582-90903604 GGCAAAAGGTATTGGGCTCCTGG - Intergenic
1123770296 15:23521972-23521994 GGCATCTGGTAAGGGCCTTCTGG + Intergenic
1125543372 15:40485582-40485604 TGCAACTTGTATTGTTCCTCTGG - Intergenic
1125682778 15:41543125-41543147 CGGAACTGGTATTTGACTTCTGG - Intronic
1133557771 16:6922047-6922069 GGCAGCTGGTATTACTATTCAGG + Intronic
1133582566 16:7160290-7160312 GGCAAGTTGCATTAGTCTTCTGG + Intronic
1137760047 16:50933294-50933316 GGCAACTGGGGCTGGCCTTCTGG - Intergenic
1141905708 16:87025527-87025549 GGCAACTAATATTGATTTTCAGG + Intergenic
1144214525 17:13043527-13043549 GGTAACTGGTATTGGTCAGCAGG + Intergenic
1150668551 17:67169356-67169378 GGCATATGGTGATGGTCTTCAGG + Intronic
1150709662 17:67519833-67519855 GGCAAGTGGTTTTGGGGTTCTGG - Intronic
1153175743 18:2371061-2371083 GACAACTGATTTTGGACTTCTGG + Intergenic
1154096392 18:11419853-11419875 GGCAAGTGAAGTTGGTCTTCAGG - Intergenic
1157211410 18:45745723-45745745 GGAAACTGGTATGGCTCTTTTGG - Intronic
1162779886 19:13001470-13001492 GTCAACGGGTATTGGTGTACCGG + Intronic
1164054802 19:21613647-21613669 GTCAAATGGTATTTGTCTTTAGG + Intergenic
925975208 2:9137590-9137612 TGCATCTGGTGTTGGTCATCAGG - Intergenic
928446761 2:31339721-31339743 GGCAAGTGGTATCTGTCCTCAGG - Intronic
928894625 2:36246403-36246425 GGCAACTGCAATTTTTCTTCAGG - Intergenic
930429134 2:51251543-51251565 GGGCAGTGGTATTTGTCTTCAGG - Intergenic
937576657 2:123430927-123430949 GCCTACTGATATGGGTCTTCAGG - Intergenic
940322460 2:152391283-152391305 GGCAACTGGTAATGACCTTCTGG + Intronic
947523499 2:230865365-230865387 GGCGTCTGGTTCTGGTCTTCAGG + Intronic
1171204450 20:23267958-23267980 GGCAACTGGCAGTGATCTCCTGG - Intergenic
1179164829 21:38927238-38927260 GGAAACTGGTTTTGGACTTCTGG - Intergenic
1180919637 22:19514809-19514831 GGCAGCTGGCAATGGTCTGCTGG - Exonic
956999616 3:74870259-74870281 GACAACTCGTATAGGTCTGCTGG - Intergenic
958625776 3:96622729-96622751 AGCAACTGGAAATGGTCTTAGGG + Intergenic
965043334 3:163540305-163540327 GGCAAAATGTATTGGTCTGCAGG + Intergenic
967948871 3:194824992-194825014 GACAGCTGGTTTTGGACTTCAGG + Intergenic
969659519 4:8518264-8518286 GGCAACTGCTTTTGCTCTTTTGG + Intergenic
970215743 4:13758398-13758420 AGCAACTGCTATTGCTCTTTTGG + Intergenic
972424870 4:38923083-38923105 GGGAACTCCTATTGGTCCTCTGG + Intronic
972813999 4:42623302-42623324 GTCAAGTGGTATTTGTCTTTAGG - Intronic
974534305 4:63154730-63154752 AGCAATTGTTATTGCTCTTCTGG + Intergenic
976099738 4:81548752-81548774 GGCAGCTGGTCTTGACCTTCTGG + Intronic
977840695 4:101700069-101700091 GGCAACTGGTAGTGGTAGTTTGG - Intronic
982942330 4:161573895-161573917 TGAAACTGATTTTGGTCTTCTGG - Intronic
984150867 4:176128275-176128297 GGAGACTGTAATTGGTCTTCAGG + Intronic
986433551 5:7705462-7705484 GCCAGCTGGCATTGTTCTTCCGG - Intronic
990253559 5:53942142-53942164 GGCAACTGGTCTTGCTCATGTGG + Intronic
991665604 5:68996683-68996705 GGCACCAGGTATTGGTTTTGTGG - Intergenic
1001441149 5:171743953-171743975 GGGAACTGGAATTGGGGTTCAGG - Intergenic
1002681010 5:180963887-180963909 GTCCACTGGTGTTGGTCTTCAGG + Intergenic
1006225831 6:32535455-32535477 GGCAACTGGTGCTGGCCTACAGG + Intergenic
1006434279 6:34018199-34018221 GGCAACTGGTATCTGCCCTCAGG - Intergenic
1006895093 6:37463119-37463141 GGCAACTGGGTTTGGTCTGCTGG + Intronic
1007274636 6:40664260-40664282 GGCAAGAGGTCTTGGTCTTAGGG - Intergenic
1010393570 6:75364499-75364521 GTAGACTGCTATTGGTCTTCAGG + Intronic
1014489597 6:122045688-122045710 CCCATCTGGTTTTGGTCTTCTGG - Intergenic
1014532002 6:122569716-122569738 AGTAACTGTTATTGCTCTTCTGG - Intronic
1017708203 6:157144036-157144058 GGCAGCTGGTCTTCGTCTCCTGG - Intronic
1017959351 6:159208289-159208311 GGCAACTGGTATTGGTCTTCTGG + Intronic
1018739256 6:166714833-166714855 GGGACCTGGTATTGGTGTCCTGG - Intronic
1018877939 6:167842193-167842215 GGCAACTGGTTTTGGTAATCAGG - Intronic
1020626940 7:10592798-10592820 TTCAGCAGGTATTGGTCTTCCGG + Intergenic
1022464743 7:30646220-30646242 GGTAACTGGTATTGGCATTTCGG + Intergenic
1024420967 7:49166262-49166284 GGTAACAGGTATTGGCCTCCTGG - Intergenic
1029835861 7:103309063-103309085 GGCAACTGGGATCGCTCTTTTGG + Exonic
1031017367 7:116589509-116589531 GGCAACTCATATTGTCCTTCAGG + Intergenic
1031762321 7:125729160-125729182 ACCAACTGGTATTGTTCTTTGGG + Intergenic
1033512398 7:142072034-142072056 GCCAACTGGTATTGGATTTAGGG - Intronic
1035325642 7:158064351-158064373 GGCATCTCGTCTTGGTCGTCTGG - Intronic
1038726857 8:30089390-30089412 GGCAACTGGGATTACTCATCAGG - Intergenic
1039892068 8:41692571-41692593 TGCACCTGGTAATGGTGTTCTGG + Intronic
1040447630 8:47511692-47511714 GGCAAATGGTCTTGGTGTACTGG + Intronic
1041929167 8:63268226-63268248 GGCGACAGTGATTGGTCTTCAGG - Intergenic
1043383655 8:79728429-79728451 GGCATCTGGTGTTGGACATCTGG - Intergenic
1048212402 8:132466353-132466375 GACAACTGGTAGTCGTCCTCTGG - Intronic
1054869467 9:70036131-70036153 TGCCACTGATCTTGGTCTTCTGG - Intergenic
1054921509 9:70547644-70547666 GGCACCTGGGATTGGTCTTGAGG + Intronic
1056681899 9:88726414-88726436 GGCAACTGCAAATGGTCTCCAGG + Intergenic
1057182444 9:93037400-93037422 GGCACCTGGAATTGGCCTGCCGG + Intergenic
1058599046 9:106649587-106649609 GGGAATTGCTATTGATCTTCTGG - Intergenic
1059778072 9:117496345-117496367 GTCAAATGGTATTTGTCTTTAGG + Intergenic
1060143012 9:121226761-121226783 GGCAACTCTTATTGGGCTCCCGG + Intronic
1186728343 X:12381657-12381679 GTCAATTTGTAATGGTCTTCTGG - Intronic
1187900502 X:24023431-24023453 GACAACTGGTATTGGACTAGAGG + Intronic
1190223281 X:48527048-48527070 GGAGACTGGCATTGGTTTTCGGG + Intronic
1191671821 X:63755207-63755229 GGCATCTGTTATTGGTCGGCGGG - Intronic
1192385854 X:70668775-70668797 GTCAACTTGTATTCCTCTTCTGG + Intronic