ID: 1017962349

View in Genome Browser
Species Human (GRCh38)
Location 6:159233287-159233309
Sequence CTGTGGATTTGGGGTTCTCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 292}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017962349_1017962359 -1 Left 1017962349 6:159233287-159233309 CCCAGAGAACCCCAAATCCACAG 0: 1
1: 0
2: 2
3: 37
4: 292
Right 1017962359 6:159233309-159233331 GGGGCAGATACACATCCTCAGGG 0: 1
1: 0
2: 0
3: 11
4: 144
1017962349_1017962361 16 Left 1017962349 6:159233287-159233309 CCCAGAGAACCCCAAATCCACAG 0: 1
1: 0
2: 2
3: 37
4: 292
Right 1017962361 6:159233326-159233348 TCAGGGCAAGTACTCCTCCCTGG 0: 1
1: 0
2: 1
3: 14
4: 164
1017962349_1017962358 -2 Left 1017962349 6:159233287-159233309 CCCAGAGAACCCCAAATCCACAG 0: 1
1: 0
2: 2
3: 37
4: 292
Right 1017962358 6:159233308-159233330 AGGGGCAGATACACATCCTCAGG 0: 1
1: 0
2: 2
3: 14
4: 118
1017962349_1017962362 25 Left 1017962349 6:159233287-159233309 CCCAGAGAACCCCAAATCCACAG 0: 1
1: 0
2: 2
3: 37
4: 292
Right 1017962362 6:159233335-159233357 GTACTCCTCCCTGGCCTCCAAGG 0: 1
1: 0
2: 1
3: 23
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017962349 Original CRISPR CTGTGGATTTGGGGTTCTCT GGG (reversed) Exonic