ID: 1017964501

View in Genome Browser
Species Human (GRCh38)
Location 6:159252243-159252265
Sequence CTGTGTAAGAGGAAGAAGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 338}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017964501 Original CRISPR CTGTGTAAGAGGAAGAAGTA TGG Intronic
900153820 1:1195644-1195666 CTGTCTAAAAAAAAGAAGTATGG - Intronic
902075161 1:13778706-13778728 CTGTGAAAGAGCCAGAAATACGG + Exonic
902682317 1:18052077-18052099 GTGTGTTAGGGGAAGGAGTAGGG - Intergenic
902872810 1:19324610-19324632 CTGTGGAAGAGGAAGAGGAAGGG - Intronic
905354520 1:37372147-37372169 CTGAGGAAGAGGATGAAGTCTGG - Intergenic
906256975 1:44357853-44357875 CTGTGTGACAGGGAGAAGGAAGG + Intergenic
906680216 1:47721200-47721222 CTGTGGGAGAGGAAGCAGAATGG - Intergenic
906680445 1:47722611-47722633 CTGTGGAAGAGGAAGATTTCAGG + Intergenic
907317069 1:53579302-53579324 CTGTGTCAGAGAGAGAAGCATGG - Intronic
907570013 1:55474612-55474634 CTGTGGAACAGGAAGAGATAAGG - Intergenic
908798893 1:67858623-67858645 CTCACTAAGAGGAAGAAGGATGG - Intergenic
908874088 1:68649717-68649739 CTGTGAAAGGGAAAGAAGGATGG - Intergenic
908947071 1:69511141-69511163 CTGCTGCAGAGGAAGAAGTAGGG - Intergenic
909295665 1:73945132-73945154 CTGTGTTAGAGGAAGATTTTTGG - Intergenic
909730040 1:78878783-78878805 CTGTGTAAAAGCAGGAAGAAAGG - Intergenic
910732175 1:90409942-90409964 TTCTGTAAAAGGAAAAAGTATGG - Intergenic
911045963 1:93628564-93628586 ATGTCTAAGGGGAAGAAGAAGGG - Intronic
911679266 1:100695479-100695501 CTGTCTAAGTGGAAGATGCATGG + Intergenic
912512846 1:110200233-110200255 CTGTGGAAGAGGGATGAGTAAGG - Exonic
912596083 1:110877821-110877843 CAGTTGTAGAGGAAGAAGTAGGG - Intronic
912627374 1:111216652-111216674 CAGTGTAAGAGGAAGGATAATGG - Intronic
913441609 1:118904327-118904349 CAGTGAAGGAGAAAGAAGTATGG - Intronic
914396115 1:147270141-147270163 AAGTGTAAGAGGAAAAATTATGG - Intronic
917270365 1:173266102-173266124 GTGTGCAAGAGTAAGAAGGATGG + Intergenic
917298326 1:173545480-173545502 CTGTTTAAGAGGGGGAAGAATGG - Intronic
917719979 1:177778085-177778107 CTGTGGAAGAGGAATGTGTATGG - Intergenic
917773425 1:178305967-178305989 ATGTGTATGGGGAAGAAGAAGGG + Intronic
918044444 1:180933283-180933305 GAGTGTAAGAGGAAGCAGGAAGG + Intronic
918140681 1:181717074-181717096 GTGCCTAAGAGGGAGAAGTAAGG - Exonic
919345313 1:196368771-196368793 ATGTGAAGGAGGAAGTAGTAGGG - Intronic
920908617 1:210193600-210193622 CTGTGTAAGAGCAGGAAGAAAGG - Intergenic
922131991 1:222789014-222789036 CTATGTAAGAGGAGGAAATAGGG + Intergenic
922143237 1:222911457-222911479 CTGTAAAAGAGGAAAAAGAAGGG - Intronic
922369060 1:224891538-224891560 CTGTGTAAGAGCAGGAAGAAAGG - Intergenic
923314058 1:232762298-232762320 CTGAGGAAGAGGAAGAAGGATGG - Intergenic
924009693 1:239651548-239651570 CTGGGGAAGGGGAAGAAGTGAGG - Intronic
924293270 1:242560116-242560138 CTGTGTAGGAGGAAGAGCCAGGG + Intergenic
924619403 1:245647654-245647676 TTGTGTAGGAGGAAAAAGTCGGG + Intronic
1062941433 10:1424340-1424362 CTGTGTGAGAGCAAGAAGAAAGG + Intronic
1063177911 10:3568807-3568829 ATTTGTAAGAGGAAGAAGAAGGG - Intergenic
1063444428 10:6100869-6100891 AGGTGTAAGGGCAAGAAGTATGG + Intronic
1064002291 10:11673718-11673740 GCGTGTGAGAGGAAGAAGGAAGG + Intergenic
1064813781 10:19232821-19232843 CAGTGAAAGAGCAAGAAGCAGGG - Intronic
1065806993 10:29403164-29403186 CTGTGGAAAAGGCAGAACTATGG + Intergenic
1066254448 10:33664946-33664968 CTGTGTAGTAGGAAGTAGTTTGG + Intergenic
1067006836 10:42672474-42672496 CTGAGCTGGAGGAAGAAGTAGGG + Intergenic
1067084035 10:43228869-43228891 CTGAGTAAGTGAAAGAAGGAAGG + Intronic
1069119742 10:64555295-64555317 CTGTGAAAGAGAAAGAAATTGGG - Intergenic
1069441755 10:68434993-68435015 CTGTGAAAGAGGAGGGAATATGG + Intronic
1070782344 10:79145014-79145036 CTGGGCAAGAGGAAGAAAGAAGG - Intronic
1071095407 10:81968472-81968494 CTGTGCAAGAGGAACAAAAAGGG - Intronic
1071407459 10:85351804-85351826 CATTGTAAGAGGAATAGGTAGGG + Intergenic
1071666842 10:87567015-87567037 CTGGGTAACAGGCAGAAGTTGGG + Intergenic
1073984478 10:109192857-109192879 CTGAGGAAGTGGAAGGAGTAAGG - Intergenic
1078437257 11:11335711-11335733 CTTTATAAGAGGAAAAAGAATGG + Intronic
1078815298 11:14815213-14815235 CTTTGTCAGTGGAAGAATTATGG + Intronic
1078893405 11:15577564-15577586 CTGGGGCAGAGGAAGAAGTTTGG - Intergenic
1080711868 11:34756133-34756155 CTTTTTAAGAGGAAGAACAAAGG + Intergenic
1080892023 11:36417333-36417355 CTTTGAAACAGGAAGAGGTAAGG - Intronic
1080965011 11:37204326-37204348 GTGGGGATGAGGAAGAAGTAGGG - Intergenic
1081282341 11:41225135-41225157 CCGGGTAGGAGGAAGATGTACGG + Intronic
1081509039 11:43749508-43749530 CAGTGTGAGAGGAAGCAGGAGGG + Intronic
1082026599 11:47577199-47577221 GTGCGTTAGAGGAAGAAGTCAGG - Intronic
1082614977 11:55348648-55348670 CTGGGTAACAGGAAGAGGTTGGG + Intergenic
1082982099 11:59133109-59133131 CTGGGTAACAGGAAGAAGTTGGG - Intergenic
1085013604 11:73158123-73158145 CTTTGGAAGAAGAAGAAGTATGG + Intergenic
1089935566 11:122360519-122360541 CTGTGTGTGAGGAAGAAATCAGG - Intergenic
1090419187 11:126562308-126562330 CTGAGTAAGAGGGAGGGGTAGGG + Intronic
1091300511 11:134504225-134504247 TTGTAAGAGAGGAAGAAGTAGGG + Intergenic
1091748722 12:3009771-3009793 CTGTGTCAGAGGAAGGAGTGGGG - Intronic
1091761711 12:3091860-3091882 CTGTGTTGGAGGAGGGAGTATGG + Intronic
1092735718 12:11580627-11580649 CTGTGGGAGAGAGAGAAGTAAGG + Intergenic
1092973493 12:13721505-13721527 CGGTGTAAGAAAAATAAGTAAGG + Intronic
1093024666 12:14234925-14234947 CTGTATAAGAGCAGGAAGAAAGG - Intergenic
1094146145 12:27230484-27230506 CAGTTTAAGAGAAAGAAGAAGGG - Intergenic
1094290684 12:28845752-28845774 CTATTTAAGAGGAAGAGGAAGGG - Intergenic
1094345454 12:29463422-29463444 GTGTTTAAGAGAAAGAAGAAAGG + Intronic
1095690528 12:45083506-45083528 GGGTGGAAGAGGAAGAAGTCAGG - Intergenic
1098095051 12:66946001-66946023 CTGTGTAGCAGGAAGAAGGAAGG - Intergenic
1098784420 12:74732582-74732604 ATGTGTGAGAGGAAGGAATATGG - Intergenic
1098986073 12:77013728-77013750 CTGAGGAAGAGGAAGGAGAAGGG - Intergenic
1099097547 12:78393844-78393866 ATGTGAAAGTAGAAGAAGTAAGG + Intergenic
1100698930 12:97125332-97125354 CTGTGGAGGAGGAGGATGTAAGG + Intergenic
1101335300 12:103791383-103791405 CTGTCCTAGAGGAAGAAGTGGGG - Intronic
1105575812 13:21650574-21650596 CAGAGAAAGAGGAAGAAGGAGGG - Intergenic
1106790478 13:33150909-33150931 CTGTGTACCAGGAATAAGTTAGG + Intronic
1107209499 13:37836333-37836355 CTGGGTAACAGGAAGAGGTTGGG + Intronic
1110167525 13:72461116-72461138 GGGTGTAAGAGGAAGAGGAAAGG + Intergenic
1112757609 13:102655788-102655810 CAGTGTACGACGAAGAAGGAAGG - Intronic
1112906845 13:104433103-104433125 CAGTGTAAGGGAAAGAAGTTGGG + Intergenic
1113051017 13:106212280-106212302 ATGTGGAAGAGAAAGAAGTGAGG + Intergenic
1113172566 13:107521908-107521930 GTGTGTAAGTTGAAGAAGAAAGG - Intronic
1114170969 14:20272255-20272277 CTGGGTAACAGGCAGAAGTTGGG + Intronic
1114586935 14:23824216-23824238 CAGTGTAAGAGGAAGTGGGAGGG - Intergenic
1114587083 14:23825146-23825168 AGGTGTAAGAGGAAGCAGGAGGG + Intergenic
1115569426 14:34652891-34652913 CTGTGTAAAAGCAGGAAGAAAGG - Intergenic
1115975269 14:38990288-38990310 GTGTGTAGGAGGAACAAGAAAGG + Intergenic
1116197409 14:41746695-41746717 ATGTGTAAAAGAAAGAAGAAAGG + Intronic
1117812104 14:59558168-59558190 GTGTGTTCGAGGAAGAAGGATGG + Intronic
1117910352 14:60631886-60631908 GTGTGAAAGAGGAAGATATAGGG + Intergenic
1118316600 14:64729713-64729735 CTGTGTAAGCTGGAGAAGTCTGG + Intronic
1118659800 14:67996018-67996040 CTGTGAAAAAAGAAAAAGTAGGG + Intronic
1119686610 14:76637630-76637652 CTGGGTGAGAGGAAGAAGACTGG + Intergenic
1120658740 14:87227902-87227924 GAGTGTAAGAGGAACAAGTGAGG + Intergenic
1122870846 14:104637791-104637813 CTATGCAAGAGGAGGAAGAATGG + Intergenic
1123170287 14:106366832-106366854 CTGTGTGAGAGAGAGAAGGAGGG + Intergenic
1123677822 15:22729222-22729244 CTGAGGAAGAGGAGGAAGGAGGG + Intergenic
1125482058 15:40088025-40088047 CTGGGAGAGAGGAAGAAGAAAGG - Exonic
1125757075 15:42071354-42071376 GTGTCTGAGGGGAAGAAGTAAGG - Intronic
1128593133 15:68920456-68920478 CAGAGTAAGAGTAAGGAGTAAGG + Intronic
1130620429 15:85456352-85456374 CTGATTAAGAAGAAGAAGTCAGG - Intronic
1131449825 15:92529971-92529993 CTGAGTAACAGGCAGAAGTTTGG + Intergenic
1131570061 15:93525359-93525381 CTGAGGAAGAGGCAGCAGTAAGG - Intergenic
1131675457 15:94666470-94666492 CTCAGCAAGAGAAAGAAGTAAGG + Intergenic
1132367631 15:101269099-101269121 CTGACTAAGGGGAAGAAGTCAGG - Intergenic
1135506169 16:23038367-23038389 TTCTGGAAGAGGAAGAAGGAAGG + Intergenic
1137054790 16:35739425-35739447 CTGTGTAAGAATAAGAAGAAAGG + Intergenic
1137298245 16:47118741-47118763 GTATGTAAGAGGTAGAAGTTAGG - Intronic
1138411102 16:56841018-56841040 CTATTTTAGAGAAAGAAGTAAGG + Intronic
1138559537 16:57792592-57792614 CCGTGTAAAAGAAAGAGGTAGGG + Intronic
1138973526 16:62174738-62174760 AAGTGTAAGAAGAAAAAGTATGG - Intergenic
1139695501 16:68671451-68671473 CTTTAGAAGAGGAAGAAGTTTGG - Intronic
1140402596 16:74683778-74683800 CTGTGTGGGAGGAATGAGTAGGG + Intronic
1140682125 16:77395401-77395423 CTCTGTAGGAGGAAGAAGTATGG - Intronic
1141018710 16:80474815-80474837 CTTTATAAGTGGAAGAAGGAAGG - Intergenic
1142013146 16:87727298-87727320 CTGTGTAAGAAAACGCAGTATGG - Intronic
1143258393 17:5581259-5581281 CTGTGTAAGAGTTAAAAGTGTGG + Intronic
1144277484 17:13687860-13687882 CTGAGGAAGAGGAAGAAGAGAGG - Intergenic
1144662180 17:17078287-17078309 TTGAGTGAGAGGAAGAAGTGAGG + Intronic
1144839265 17:18175693-18175715 CTGGGCAGGAGGTAGAAGTATGG - Intronic
1145193138 17:20865447-20865469 CTTTGCAAGAGGAAAAAGAAAGG - Exonic
1145260187 17:21349941-21349963 CTGTGTAAGAGGCTTCAGTAGGG - Intergenic
1145403553 17:22567452-22567474 CTTTGCAAGAGGAAAAAGAAGGG - Intergenic
1145723364 17:27092385-27092407 CTTTGCAAGAGGAAAAAGAAAGG + Intergenic
1145944302 17:28761427-28761449 TTTTGCAAGAGGAGGAAGTAAGG - Intronic
1146052167 17:29562811-29562833 CTGAGCAGGAGGAAGAAGTAGGG + Exonic
1147112962 17:38277457-38277479 CTGTGACAGAGGAAGGAGAATGG - Intergenic
1147654507 17:42081162-42081184 CTGGGTTAGGGGAAGAAGGATGG + Intergenic
1148416659 17:47511768-47511790 CTGTGACAGAGGAAGGAGAATGG + Intergenic
1150862187 17:68812034-68812056 CTGTGTAAGATAAATAAATATGG - Intergenic
1151887552 17:76932130-76932152 CTGTGTAAGAAGAAGAAAGAAGG - Intronic
1152267659 17:79305634-79305656 CTGTGTGGGAGGAAGACGCAGGG - Intronic
1153041239 18:814370-814392 CTGTGCAGGAGGGAAAAGTAGGG - Intergenic
1153796884 18:8631683-8631705 TTTTGTAAGGGGAAGAAATATGG + Intronic
1154369303 18:13744680-13744702 CTATGTAAGAGGTATACGTAAGG - Intronic
1155530225 18:26759166-26759188 CAGTGGAAGAGGAACAAGTCTGG + Intergenic
1156381595 18:36566754-36566776 CTGTCTCAGAGGAACAATTAAGG + Intronic
1156569650 18:38238954-38238976 GTCTGTCACAGGAAGAAGTAAGG + Intergenic
1156815155 18:41301215-41301237 TTCTGGAAGAGGAAGAAGTGTGG + Intergenic
1158380386 18:56923539-56923561 CTGTGTTAGATGCAGAAGAAAGG + Intronic
1158929373 18:62307674-62307696 CTGTTTAAAAGGAATGAGTATGG - Exonic
1159002408 18:62986157-62986179 CTGTTCATAAGGAAGAAGTATGG - Intergenic
1160264156 18:77324426-77324448 TTGTGTAAGAGGAAGAACTTGGG + Intergenic
1160303143 18:77704712-77704734 CTTGGTAAGAGGAAGAAATAGGG - Intergenic
1161845917 19:6711916-6711938 CCGTGTAAGTGGAAGGAGCAGGG + Intronic
1162262861 19:9546708-9546730 CTGTGTAAGAGCAGGAAAAAAGG - Intergenic
1162648034 19:12064443-12064465 CTGTGCAGGACGAAGAAGCAGGG + Intergenic
1162873771 19:13605752-13605774 CTGTGAAATGGGAAGAAGAATGG - Intronic
1163667414 19:18609900-18609922 ATGTGTAAGGGGCAGAAGGAGGG + Intronic
1166623400 19:44326388-44326410 GTGTGTGAGTGGGAGAAGTATGG + Intergenic
1166826723 19:45614451-45614473 TTGTGTAAGAGGAAAGGGTAGGG - Intronic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
928499573 2:31876156-31876178 GTGTGTAAGAGTAAGAAGAGTGG - Intronic
928619952 2:33078504-33078526 CTGTGTGAGAGGAATAATTGTGG + Intronic
930098438 2:47584869-47584891 CTGTGTAAGAGTGGGAAGAAAGG + Intergenic
930541470 2:52712215-52712237 CTGTGTGAGTGGTAGATGTATGG + Intergenic
930564144 2:52998659-52998681 GTGTGTAAAAGAAAGAAGTGAGG + Intergenic
932288803 2:70557854-70557876 CTGTGTATGAGAAAGAAAGAGGG + Intergenic
932294786 2:70615339-70615361 TTGTGTAAGAGGAAGGTGTCTGG + Intronic
933251095 2:80029303-80029325 CTCTCACAGAGGAAGAAGTAAGG - Intronic
934149730 2:89134859-89134881 CTGTATAAGATGAAGATGTTGGG - Intergenic
934217566 2:90047172-90047194 CTGTATAAGATGAAGATGTTGGG + Intergenic
935034555 2:99356687-99356709 CTGTGTAATGGTAGGAAGTAAGG - Intronic
935473661 2:103490807-103490829 CTGAGGAAGAGGAAGAAGAGGGG - Intergenic
937011468 2:118566554-118566576 ATGTGACAGAGGAAGAAGGAGGG + Intergenic
937706000 2:124921597-124921619 CTTTGTAAGAAAAAGATGTAGGG - Intergenic
937786292 2:125903421-125903443 CAGTGAAAGAAGAGGAAGTAAGG + Intergenic
938588524 2:132715184-132715206 ATGTGCAAGAGGAAAAAGCAAGG - Intronic
939282515 2:140082834-140082856 CTGTTGAAGAGAAAGAAATATGG - Intergenic
939419279 2:141944830-141944852 GTGTGTTAGAGGGAGAAGAAAGG - Intronic
939548451 2:143582987-143583009 CTGTGTAGATGGAAGAAGTGTGG + Intronic
939634363 2:144563242-144563264 CTGGGAAGGAGGAAGAAATAGGG - Intergenic
939728983 2:145757965-145757987 CTGTGCAAGAGGATGGAGTTTGG + Intergenic
941707385 2:168674335-168674357 CTGTGGAAGAGGAAAAGGGATGG - Intronic
941871241 2:170388245-170388267 CGGTATATGAGGAAGCAGTAGGG + Intronic
941930523 2:170934554-170934576 CTGTGTTAGGGGATGAGGTAGGG - Intronic
942421757 2:175815077-175815099 CTTTGAAAGAGGAAGAGCTATGG - Intergenic
942981225 2:182084704-182084726 CTGTGTAAGATGAACAAATCTGG - Intronic
943287500 2:186021844-186021866 TTATGTAAGAGAAAGAAATAAGG - Intergenic
943569784 2:189559737-189559759 CTGTGTAGGAAGAAGAAGCATGG - Intergenic
943689897 2:190858898-190858920 CTCTGTAGGAGAAAGAAGAATGG + Intergenic
944110334 2:196124906-196124928 CTGGGTAATAGGAATAAATAGGG - Intergenic
944148244 2:196529466-196529488 GTGTGACAGATGAAGAAGTAAGG - Intronic
944304404 2:198163201-198163223 CTGAGTAAGAGGGAGAAGACTGG - Intronic
944971987 2:205003445-205003467 CTTTGTAAGAAAAAGTAGTAGGG - Intronic
945080084 2:206079762-206079784 CTGTGTTAGGGGAAGGAGTTTGG - Intronic
945184392 2:207124403-207124425 GTCTGCAAGAGGAAGAAGGAGGG + Exonic
945232598 2:207608213-207608235 CTGGGAAAGAGGAAGAAATTGGG - Intronic
945572774 2:211490673-211490695 GTTTGTGAGACGAAGAAGTATGG + Intronic
946446356 2:219742857-219742879 ATCTGTAAGGGGAAGAAATATGG - Intergenic
947409794 2:229824816-229824838 TTATGTGAGAGGAAGAAGCAGGG + Intronic
948593797 2:239067036-239067058 CTGTTTGAGAGGAGGAATTATGG + Intronic
1169866231 20:10202944-10202966 CTGAGGAAGAGGAGGAAATACGG - Intergenic
1170572084 20:17638145-17638167 GTGTGTTAGAGGAGGAAGTGCGG - Intronic
1171561706 20:26132933-26132955 CTTTGCAAGAGGAAAAAGAATGG - Intergenic
1172066877 20:32227652-32227674 CTGTGTATGAGGGGGAAGCAGGG + Intronic
1172773460 20:37394596-37394618 CTGGGGAAGAGGAAGAAGCGGGG - Intronic
1173185247 20:40835585-40835607 CTGTGTCAGAGGCAGATGCATGG + Intergenic
1173955028 20:47024982-47025004 CTGAGGAAGAGGAAGAAGATAGG - Intronic
1174103101 20:48142201-48142223 CTGTGTATGAGGAGGGAGGAGGG - Intergenic
1174397476 20:50256794-50256816 ATGTGTAAGGGGAGGAAGTGGGG + Intergenic
1175705610 20:61174431-61174453 TGGTGCAACAGGAAGAAGTAGGG - Intergenic
1177762682 21:25419723-25419745 CTTTGTTAGAGGAAGCAGGATGG - Intergenic
1181780706 22:25190896-25190918 CTGTGTAAGGGGAAGAATGAGGG + Intronic
1182571104 22:31238718-31238740 CTCTGTAAAAGGAAGGAGTTAGG - Intronic
1183198362 22:36368887-36368909 TTGTGTAAAAGCCAGAAGTAAGG + Intronic
949223094 3:1659374-1659396 CTGGGTAGAAGGCAGAAGTAAGG + Intergenic
949542226 3:5041865-5041887 CTGTGTCAGAGGAAGATCTGGGG + Intergenic
949585978 3:5437629-5437651 CTGCATAAGATGAAGAAGCATGG - Intergenic
949977304 3:9472756-9472778 CTGTTTGAGAGAAAGAAGCAGGG - Intronic
950466408 3:13157776-13157798 CTGTGGCAGAGGGAGAAGAAAGG + Intergenic
951299794 3:20981777-20981799 CTGTGTAAGAGGTTGGAGCAGGG + Intergenic
952297482 3:32074068-32074090 CTGTGTAAGAGCAGGAAGAAAGG - Intronic
952512603 3:34072216-34072238 CTGAGTATGAGGAAGAAATGTGG + Intergenic
952787595 3:37171118-37171140 CTTAATAAGAGGAAGAAGCAGGG + Intronic
952864882 3:37848323-37848345 CTGTGTAAGAAGGAGAAGCCAGG + Intergenic
953041119 3:39255733-39255755 CTGTGGTAGAGGGAGCAGTAGGG + Intergenic
955044750 3:55349222-55349244 CTGAGTATGGGGAAGAAGCATGG - Intergenic
955513540 3:59705230-59705252 CTGTATAAGAAGAAAAAGTGTGG + Intergenic
958031919 3:88121886-88121908 CTGTGTAAATGGAAGCACTATGG - Intronic
958755748 3:98247706-98247728 CTGTGTAACAGCAGGAAGAAAGG - Intergenic
959305885 3:104665586-104665608 CTGGGTAACAGGAAGAGGTTGGG + Intergenic
959542662 3:107558080-107558102 CTGGGTTAGAGGAAGAAGCCAGG + Intronic
959573093 3:107906619-107906641 CTGTGAAGGAAGAAGAAGTGTGG - Intergenic
959688489 3:109173356-109173378 CTCAGTTGGAGGAAGAAGTATGG + Intergenic
959712949 3:109402959-109402981 GTGTGTAAGAGAGAGAAGCAGGG + Intergenic
959935000 3:112020117-112020139 CTGTGTAAAAGGAATAAAGATGG + Intergenic
962163464 3:133023950-133023972 TTGTATAAGAGGAAGAATTTGGG - Intergenic
962345937 3:134619088-134619110 CTGTGGAAGAGGGAGAGGGATGG + Intronic
963065789 3:141263236-141263258 CTGTGGAAGTGGAGGTAGTAAGG + Intronic
964468565 3:157026237-157026259 CAGAGTGAGAGGAAGAAGAAAGG - Intronic
967903146 3:194477570-194477592 CTGATTAAGAGGAAGAGGAAGGG - Intronic
968075825 3:195815767-195815789 CTGTGTAAGAAGAAGGAGGCCGG - Intergenic
968412433 4:401688-401710 CTGTGTAAGAGCAGGAAGAAAGG + Intergenic
968766782 4:2475745-2475767 CTGTAAGAGAGTAAGAAGTAGGG - Intronic
968914191 4:3490029-3490051 ATGAGTAGGAGGAAGAAGGAAGG - Intronic
969309065 4:6341697-6341719 CTGTATAGGAGGAAGAAGGAAGG + Intronic
970115752 4:12694298-12694320 CTGTGTAAGAACAGGAACTATGG + Intergenic
970127367 4:12829886-12829908 CTATGTAAGAGAAACAAATAAGG - Intergenic
970819583 4:20197051-20197073 CTGTGTAAGAGCAGGAAGAAAGG - Intergenic
971806650 4:31367007-31367029 CTCTGTAAGATGAAGGAGGAAGG + Intergenic
971845800 4:31916498-31916520 CAGTGTAAAAGGGAGATGTAAGG + Intergenic
972110830 4:35557209-35557231 CTGTGGAAGTGGAAGTGGTATGG - Intergenic
972250520 4:37295128-37295150 CTGCTTAAGAGGAAAAGGTAAGG + Intronic
973082537 4:46011988-46012010 CTGGGGCTGAGGAAGAAGTATGG - Intergenic
975178826 4:71319803-71319825 CTGAGTCAGAGGGAGAAGGAGGG + Intronic
977466454 4:97387832-97387854 CTTGGAAAGAGGAGGAAGTAAGG - Intronic
978119869 4:105065518-105065540 CTGTGAAAGATGAAGAAGGAAGG + Intergenic
978745297 4:112186604-112186626 CTTTGGAAGATGAAGAACTAAGG + Intronic
979076879 4:116282389-116282411 CTTTGGAAGAGGAGGCAGTATGG - Intergenic
979192785 4:117883882-117883904 ATGTGTAATAAGTAGAAGTAAGG - Intergenic
980986118 4:139696157-139696179 CTGAGGAAGAGGAAGAAGAGGGG + Intronic
982513390 4:156313266-156313288 CTGAGTAAGAGGAAAAATAAAGG + Intergenic
983267975 4:165527702-165527724 TTGTGGACTAGGAAGAAGTAGGG + Intergenic
984865281 4:184275499-184275521 CTGTGGAAGAGGCAGAAGTCAGG - Intergenic
984929498 4:184834310-184834332 CTGTGTAATATAAAGAAATAAGG - Intergenic
985333169 4:188863389-188863411 CTGAGGAGGAGGAAGAAGAAGGG - Intergenic
986468506 5:8050689-8050711 CTGTATAAGAAGGAGAAGGAAGG + Intergenic
986737739 5:10680609-10680631 CTGTGGGAGAGTAAGAACTAAGG - Exonic
986957094 5:13165819-13165841 CTGAGGAAGAGGAGGAAGTGGGG + Intergenic
987505825 5:18770568-18770590 TTGTGTAGAATGAAGAAGTAGGG + Intergenic
989133773 5:38133297-38133319 CCTTGTCGGAGGAAGAAGTAGGG + Intergenic
989377675 5:40781809-40781831 ATGTATAAGAGAAAGAAGGAAGG + Intronic
990531665 5:56679989-56680011 CTGTGGAGGAGGAAGAAGAGTGG - Intergenic
990567267 5:57042169-57042191 TTGTGTGGGAGGAAAAAGTAGGG - Intergenic
991369937 5:65907891-65907913 TGGAGTATGAGGAAGAAGTAAGG + Intergenic
992240068 5:74758947-74758969 CTGTTTAAAAGGAAAAAATAAGG + Intronic
992856265 5:80864611-80864633 CTGTGGAGGAGGAAGAAGAAGGG + Intronic
993394828 5:87372755-87372777 CTGTATAATTGGAAGAAGTTAGG + Intronic
993866894 5:93206309-93206331 CTATGTAATAGAAAGAAGCAAGG - Intergenic
994466393 5:100138615-100138637 CTCTGTAAGAGGAAAGAATATGG + Intergenic
995291707 5:110463889-110463911 CTGTGTAAGGGGTAGAAATAAGG - Intronic
995708244 5:115007692-115007714 CTTTGGAAGAGGAAGAAGGCAGG + Intergenic
996795194 5:127338338-127338360 CTGTTTAAAATGAAGAAGTCTGG + Intronic
997071176 5:130623950-130623972 GTGAGTAAGAGAAGGAAGTAGGG - Intergenic
997157919 5:131578343-131578365 CTGTGTAAGAGCAGGAAGAAAGG - Intronic
998148120 5:139741917-139741939 TTGGGTAAGAGGCAGAGGTATGG + Intergenic
998422627 5:142001464-142001486 CTGTGAAAGTGGAAGAAGGAAGG + Exonic
999309711 5:150544285-150544307 CTAAGTAAGAGGAATAAGTCAGG + Intronic
999614430 5:153407021-153407043 CTGATAAAGAGGAGGAAGTAAGG - Intergenic
1000203035 5:159030660-159030682 CTGGGAAAGAGAAAGAAGTCTGG + Intronic
1000461295 5:161522006-161522028 CTGTGATAGAGGAAAAATTAAGG - Intronic
1001490836 5:172154026-172154048 CTGTGTTACAGAAAGAAGTCAGG - Intronic
1001935066 5:175697802-175697824 CAGCTGAAGAGGAAGAAGTATGG - Intergenic
1004271219 6:14197483-14197505 CTGTGGAAGGGGAAGAAGTGTGG + Intergenic
1005290687 6:24375843-24375865 GAGAGTAAGAGGAAGAAGGAAGG + Intergenic
1005890176 6:30130976-30130998 CTGTGTAAGAGGAAGAGGGGTGG - Intergenic
1006787329 6:36677320-36677342 CTGCGTTAGAGGAAGAAGACTGG + Intronic
1006946147 6:37785607-37785629 CTGTGTGGGAGGAAGATGGATGG - Intergenic
1009601544 6:65807590-65807612 CTGTGTAATAGCTAGGAGTAAGG + Intergenic
1010332211 6:74636438-74636460 CTCTTTAAGGGAAAGAAGTAAGG - Intergenic
1010492202 6:76489836-76489858 GTTTGTAAGAGGAAAAAGAAAGG + Intergenic
1010982091 6:82379614-82379636 TTGTGAAGGAGTAAGAAGTAGGG + Intergenic
1012064990 6:94538352-94538374 CTGAGTAAAAGGCAGAAGTTTGG - Intergenic
1012163862 6:95923922-95923944 GTCTGGAAGAGGAAGAAGTTAGG - Intergenic
1012657827 6:101847890-101847912 GTGGGTAAGAGGGAAAAGTAGGG - Intronic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1014008218 6:116445543-116445565 GGATGTCAGAGGAAGAAGTAGGG + Intergenic
1014806667 6:125837956-125837978 CTCATTAAGAGGAAGAAATATGG - Intronic
1016925885 6:149347336-149347358 CTCTTTAAGAGGAAGTAGTGTGG + Intronic
1017395502 6:153994708-153994730 CTGTGTGTGAGGGAGCAGTAGGG + Intergenic
1017964501 6:159252243-159252265 CTGTGTAAGAGGAAGAAGTATGG + Intronic
1018564566 6:165137619-165137641 CAGAGCAAGAGGAAGGAGTAGGG - Intergenic
1019965962 7:4498866-4498888 GTGTGTAAGAGGAGGGAGTCAGG - Intergenic
1019969141 7:4526131-4526153 CAGGGGAAGAGGAAGAAGAAAGG + Intergenic
1021064468 7:16156512-16156534 CTGTGGGAGAGGCAGAAGTATGG - Intronic
1021504051 7:21361281-21361303 CTGTAAAAGAGGGAGAAGTGAGG - Intergenic
1022115058 7:27253634-27253656 CTGTGTAAGAGAAAGGAGATGGG + Intergenic
1022584800 7:31598121-31598143 CAGTGTAAGTGTAAAAAGTAAGG + Intronic
1022921551 7:35021007-35021029 CTGTTTAAAATGAAGAATTAGGG - Intronic
1023073624 7:36461746-36461768 CTCTTTAAGAGGTAGAAATATGG - Intergenic
1024899631 7:54304020-54304042 CTGTGGAAGAGGCAAAACTATGG + Intergenic
1025075801 7:55942110-55942132 CTGTGGAAGATGGAGAAGTGAGG + Exonic
1025276173 7:57582772-57582794 CTTTGCAAGAGGAAAAAGAAGGG + Intergenic
1025996236 7:66529251-66529273 CTGTGGGAGAGGAAGGAGGATGG + Intergenic
1026814355 7:73498510-73498532 TTGTGAAAGAGGATGAAGGAAGG - Exonic
1026988200 7:74568157-74568179 CTGTGGGAGAGGAAGGAGGATGG + Intronic
1030160862 7:106507220-106507242 CTGGGCAATAGGAAGAACTAAGG - Intergenic
1030537173 7:110782983-110783005 CAATGGAAGAGGAATAAGTAAGG + Intronic
1031057968 7:117014623-117014645 TTGAGTACTAGGAAGAAGTATGG + Intronic
1032189031 7:129752265-129752287 CAGTGTAAAAGGAAGGAGTGGGG + Intronic
1032752991 7:134861071-134861093 CTGGGAAGGAGGAAGAAGCATGG + Intronic
1032826553 7:135575370-135575392 CTGTGCAAGAGGGTGAAGCAAGG + Intronic
1033407778 7:141087324-141087346 ATGTGTAAGAGGAGGAAATCAGG + Intronic
1034934887 7:155192566-155192588 CTGTGTGAGAGGAGAAAGGAAGG + Intergenic
1035945356 8:3955634-3955656 CGGTGAAAGAGGAAGTAGTGAGG - Intronic
1037606250 8:20439861-20439883 CTGTGGAAGAGGAAGAAACATGG - Intergenic
1038375227 8:27033539-27033561 CTGGGTAAGAGGAAGCAGGATGG - Intergenic
1039603519 8:38862218-38862240 CTGCATAAGAGGAAGAAATGTGG - Intergenic
1040651618 8:49455523-49455545 GTGTGTAAGTAGAGGAAGTAGGG - Intergenic
1041494315 8:58469051-58469073 CTGGGTAATAGGCAGAAGTTGGG + Intergenic
1041532353 8:58883667-58883689 CTGGGTAAGTGGACAAAGTATGG + Intronic
1041552077 8:59114096-59114118 CAGTGGAACAGGAAGAAGTAGGG - Intronic
1042014492 8:64292989-64293011 CTGAGATAGAGGAGGAAGTAAGG - Intergenic
1042093795 8:65189464-65189486 CTTTGTAAGAGGTGGAAGAAAGG + Intergenic
1042224405 8:66504274-66504296 CTTTGTAGAAGGAGGAAGTAAGG - Intronic
1042835048 8:73072108-73072130 CTGTGTGAGAGGAAGGAGAGGGG + Intronic
1043194979 8:77280714-77280736 CTTTGTAAGAAGAAGCAGTTTGG - Intergenic
1045497848 8:102723241-102723263 CTGTAAAAGAGGAAGAATAATGG - Intergenic
1045609126 8:103814577-103814599 CTGTTTAAGAAGGAGAAGTCAGG + Intronic
1047284244 8:123472797-123472819 CTGTGGAAGAGAAAGAGGCAGGG + Intergenic
1048573122 8:135671160-135671182 GTGGGTAAGAGGAAGAAGCCAGG + Intergenic
1049053179 8:140215200-140215222 CTGGGTAAGAGGGAGCAGTTGGG - Intronic
1049391448 8:142373631-142373653 CTGTGTCAGAGGTAGAAGGAGGG - Intronic
1049483072 8:142836397-142836419 ATGTGTAAGAGGCAGAAATAAGG - Intronic
1049865955 8:144935878-144935900 CTGTAGGAGATGAAGAAGTAAGG - Intronic
1050756093 9:9005350-9005372 ATGTGTAAGTGGAAGTAGCATGG + Intronic
1052384235 9:27806017-27806039 GTGTGGAAGAGGAAGAAGTAGGG + Intergenic
1052691671 9:31822913-31822935 CTGTGCAAGAGCAAAGAGTATGG - Intergenic
1058269755 9:102956323-102956345 CTTTTTCAGTGGAAGAAGTAGGG + Intergenic
1059045329 9:110860716-110860738 CTGGGTAACAGGCAGAAGTTTGG + Intergenic
1059123700 9:111663674-111663696 CTGTTTGAGGGGAAGAAGTCAGG + Intronic
1060900561 9:127253814-127253836 CTGTTTAACAGGAAGAAGGGAGG + Intronic
1061116840 9:128618918-128618940 ATGTGGAAGAGGAAGAAGCCTGG + Exonic
1186848426 X:13554561-13554583 CTTTTTAAAAGGAAGAAGTTTGG - Intergenic
1188187420 X:27131566-27131588 CTGGGTAACAGGCAGACGTAGGG - Intergenic
1189050677 X:37642009-37642031 CTGGATAAGTGGAAGAAATAGGG + Intronic
1189201654 X:39201435-39201457 GTGTGTAAGAGGAAGTGGGAAGG - Intergenic
1192327557 X:70145889-70145911 CTATGAAAGAGCAAAAAGTAAGG - Intronic
1194706960 X:97187229-97187251 ATGTATTAGAGGAAGGAGTAGGG + Intronic
1195869333 X:109469790-109469812 CTGTGTAAGAGGAAGGTGGGAGG + Intronic
1196046096 X:111258061-111258083 CTGGGAAGGAGGATGAAGTAAGG - Intronic
1196120494 X:112045265-112045287 CTGTAGAAGAGGAATAGGTAAGG + Intronic
1198619615 X:138491672-138491694 CTGCTTCAGAGGAAGAAGAAAGG - Intergenic
1199837866 X:151611490-151611512 CTGTGTAGGAGGCAGAATAATGG + Intronic
1200832438 Y:7700139-7700161 CTAGATTAGAGGAAGAAGTATGG + Intergenic
1201540478 Y:15100491-15100513 CTGTGTAAGTGCAGGAAGAAAGG + Intergenic
1201904048 Y:19071767-19071789 CTGTGTAAGTGGAAAAAAAAGGG + Intergenic