ID: 1017964620

View in Genome Browser
Species Human (GRCh38)
Location 6:159253416-159253438
Sequence CACATTATCGGGCCCCCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017964616_1017964620 11 Left 1017964616 6:159253382-159253404 CCAAGTGAATACATCCTAAACTT 0: 1
1: 0
2: 1
3: 16
4: 148
Right 1017964620 6:159253416-159253438 CACATTATCGGGCCCCCTGCAGG No data
1017964617_1017964620 -3 Left 1017964617 6:159253396-159253418 CCTAAACTTAAATGAAGCATCAC 0: 1
1: 0
2: 1
3: 14
4: 221
Right 1017964620 6:159253416-159253438 CACATTATCGGGCCCCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017964620 Original CRISPR CACATTATCGGGCCCCCTGC AGG Intronic
No off target data available for this crispr