ID: 1017965443

View in Genome Browser
Species Human (GRCh38)
Location 6:159260663-159260685
Sequence CCTGTCAACCATAAGTTGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 28
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 26}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017965439_1017965443 -7 Left 1017965439 6:159260647-159260669 CCAGGTTCATCCTCTCCCTGTCA 0: 1
1: 0
2: 1
3: 25
4: 350
Right 1017965443 6:159260663-159260685 CCTGTCAACCATAAGTTGCGTGG 0: 1
1: 0
2: 0
3: 1
4: 26
1017965437_1017965443 0 Left 1017965437 6:159260640-159260662 CCTCCAGCCAGGTTCATCCTCTC 0: 1
1: 0
2: 1
3: 37
4: 331
Right 1017965443 6:159260663-159260685 CCTGTCAACCATAAGTTGCGTGG 0: 1
1: 0
2: 0
3: 1
4: 26
1017965438_1017965443 -3 Left 1017965438 6:159260643-159260665 CCAGCCAGGTTCATCCTCTCCCT 0: 1
1: 0
2: 2
3: 22
4: 341
Right 1017965443 6:159260663-159260685 CCTGTCAACCATAAGTTGCGTGG 0: 1
1: 0
2: 0
3: 1
4: 26

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017965443 Original CRISPR CCTGTCAACCATAAGTTGCG TGG Intronic
915525680 1:156474961-156474983 CCTGTTAACCATAAGTAGGTGGG + Intronic
917497645 1:175555854-175555876 CCTTCCAACCATGAGTTGTGTGG + Intronic
1066258936 10:33710196-33710218 CCTTTCAAACATATGTTCCGAGG + Intergenic
1069546020 10:69329611-69329633 CCTGTCATTCATGAGTTGTGTGG - Intronic
1069978314 10:72233451-72233473 CCTGTCATCCATATGGTGCCTGG + Exonic
1086467601 11:87071285-87071307 CCTGTCAAACATAAGTGGATAGG + Intronic
1106128909 13:26923118-26923140 CCTGTCCACAAGAAGTTGTGAGG + Intergenic
1115758147 14:36549995-36550017 CCCGTCACCCATAAGGTGCTGGG - Intergenic
1153600203 18:6773606-6773628 CCTTCTGACCATAAGTTGCGTGG + Intronic
1158124489 18:54086417-54086439 TCTATCAAACATGAGTTGCGGGG + Intergenic
928249714 2:29664816-29664838 CATGTCAGCCCTAAGTTGTGAGG - Intronic
1170874954 20:20241861-20241883 ACTGTCAGCCATAAGTAGCTGGG + Intronic
1175084848 20:56450007-56450029 CCTCTCAACCAAAGGTTGGGGGG - Intronic
950348017 3:12316786-12316808 CCTGTGTACCATAAATTGTGAGG + Intronic
953952540 3:47202710-47202732 CCTGTCAATCATATGTAGTGAGG - Intergenic
964790640 3:160450732-160450754 CCTGTCAACCTTAAATAGTGAGG + Intronic
968483930 4:849766-849788 CCTGTCACCCATAGGCTGCGGGG - Exonic
972145953 4:36025719-36025741 ACTGTCAATCATAAGTAACGTGG - Intronic
974668922 4:65002947-65002969 CATGTCAACCAAAAGTAGAGTGG + Intergenic
991624690 5:68588103-68588125 GCTGTTAACCACAAGTTGCCTGG - Intergenic
1013337858 6:109183329-109183351 CCTGGGACCCATAAGTTGCAGGG - Intergenic
1017965443 6:159260663-159260685 CCTGTCAACCATAAGTTGCGTGG + Intronic
1020238715 7:6375515-6375537 CCTGTCGAAAATAAGTTGAGAGG - Intronic
1046509640 8:115185775-115185797 TCTGTCAAACATGATTTGCGTGG - Intergenic
1048166052 8:132062372-132062394 CCTGTGAACCACAAGGTGCCTGG - Intronic
1048257387 8:132915411-132915433 CCTGTCAACAAGAAGATGGGAGG + Intronic
1062324637 9:136006131-136006153 CCTGCCACCCAAAAGGTGCGTGG - Intergenic
1198455145 X:136809841-136809863 CCTGCCAACCATAAGTTCAAAGG + Intergenic