ID: 1017966594

View in Genome Browser
Species Human (GRCh38)
Location 6:159272168-159272190
Sequence GTGTGCATAGTATGTATCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 70}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017966594_1017966597 13 Left 1017966594 6:159272168-159272190 CCAGGGATACATACTATGCACAC 0: 1
1: 0
2: 1
3: 8
4: 70
Right 1017966597 6:159272204-159272226 GAAGGTATGCATTCTTTTTGTGG 0: 1
1: 0
2: 2
3: 16
4: 227
1017966594_1017966596 -5 Left 1017966594 6:159272168-159272190 CCAGGGATACATACTATGCACAC 0: 1
1: 0
2: 1
3: 8
4: 70
Right 1017966596 6:159272186-159272208 CACACTCTAGCAACAGTGGAAGG 0: 1
1: 0
2: 0
3: 6
4: 145
1017966594_1017966599 22 Left 1017966594 6:159272168-159272190 CCAGGGATACATACTATGCACAC 0: 1
1: 0
2: 1
3: 8
4: 70
Right 1017966599 6:159272213-159272235 CATTCTTTTTGTGGGTGCTGCGG 0: 1
1: 0
2: 0
3: 27
4: 395
1017966594_1017966601 24 Left 1017966594 6:159272168-159272190 CCAGGGATACATACTATGCACAC 0: 1
1: 0
2: 1
3: 8
4: 70
Right 1017966601 6:159272215-159272237 TTCTTTTTGTGGGTGCTGCGGGG 0: 1
1: 0
2: 1
3: 19
4: 264
1017966594_1017966600 23 Left 1017966594 6:159272168-159272190 CCAGGGATACATACTATGCACAC 0: 1
1: 0
2: 1
3: 8
4: 70
Right 1017966600 6:159272214-159272236 ATTCTTTTTGTGGGTGCTGCGGG 0: 1
1: 0
2: 1
3: 54
4: 697
1017966594_1017966595 -9 Left 1017966594 6:159272168-159272190 CCAGGGATACATACTATGCACAC 0: 1
1: 0
2: 1
3: 8
4: 70
Right 1017966595 6:159272182-159272204 TATGCACACTCTAGCAACAGTGG 0: 1
1: 0
2: 1
3: 6
4: 79
1017966594_1017966598 14 Left 1017966594 6:159272168-159272190 CCAGGGATACATACTATGCACAC 0: 1
1: 0
2: 1
3: 8
4: 70
Right 1017966598 6:159272205-159272227 AAGGTATGCATTCTTTTTGTGGG 0: 1
1: 0
2: 2
3: 21
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017966594 Original CRISPR GTGTGCATAGTATGTATCCC TGG (reversed) Intergenic
910263930 1:85318256-85318278 GTGTGCATAGTATGTACACCAGG - Intergenic
916310620 1:163394916-163394938 TTATGCACAGCATGTATCCCAGG - Intergenic
922562055 1:226576466-226576488 GTGTGGAGTGTATGTGTCCCAGG + Intronic
923686373 1:236156326-236156348 GTGTGCCTGGTCTGTGTCCCAGG - Intronic
924500716 1:244635902-244635924 GTGTGTATAGTGTGTATACAGGG + Intronic
1062987998 10:1787851-1787873 AGGTGCATAGTATGTAGCCCTGG + Intergenic
1063718499 10:8554413-8554435 GTGTGCACAGTCCTTATCCCTGG - Intergenic
1063870802 10:10415797-10415819 GTGTGCATTGTTTGTACCCTGGG - Intergenic
1064876969 10:20005295-20005317 GTGTTCTTAGTATGCAACCCTGG - Intronic
1065002902 10:21353266-21353288 GTGTGCTTATGATGTATCCCAGG + Intergenic
1065090476 10:22228023-22228045 GTGTGCATAGGAAGTATTCCTGG - Intergenic
1068357823 10:55933471-55933493 GTATTAATAGTATTTATCCCTGG - Intergenic
1072141057 10:92589554-92589576 GTGTACTTTATATGTATCCCAGG + Intergenic
1072295280 10:94003620-94003642 GTGTGCATAGATTGAATTCCTGG + Intronic
1079901369 11:26190770-26190792 CTGTTCATAGTATGCATCTCTGG - Intergenic
1086194498 11:84121305-84121327 TTGTTCATAATACGTATCCCTGG + Intronic
1093018132 12:14175479-14175501 CTGGGCATATTCTGTATCCCAGG - Intergenic
1097125898 12:56774720-56774742 GAGTGCATAGGATATATCCCTGG + Intronic
1098066441 12:66622533-66622555 GGGTACATAGTATGTATTCATGG - Intronic
1106981918 13:35295971-35295993 GTGAGTATTGTATGTATCACAGG - Intronic
1109420968 13:62111723-62111745 TTGTTCAAAGTATGTCTCCCAGG + Intergenic
1122522850 14:102358208-102358230 GTGTGCACAGTGTCTTTCCCAGG - Intronic
1123151859 14:106189649-106189671 GGGTGCAAAGTATTGATCCCGGG + Intergenic
1123400256 15:19977529-19977551 GGGTGCAAAGTATTGATCCCGGG + Intergenic
1124685520 15:31778496-31778518 GTGTGCATTGTATGTAGTTCAGG - Intronic
1125076270 15:35622565-35622587 GTGTGCAAAGAATGTATCAATGG + Intergenic
1126864611 15:52923205-52923227 GTGTGGAAAGTATGTGTCACTGG - Intergenic
1134222973 16:12369728-12369750 ATGTGGTTATTATGTATCCCTGG - Intronic
1140946574 16:79773906-79773928 GTGTGTTTAGTAAGCATCCCAGG + Intergenic
1148965308 17:51429944-51429966 GAGTGCCTACTATGTACCCCTGG + Intergenic
1151878958 17:76883347-76883369 GTGTGGATACTATGTACCCCTGG + Intronic
1155845291 18:30697539-30697561 ATGTTCATTGTATATATCCCAGG - Intergenic
1161233115 19:3185370-3185392 TTGTGCATATGATGTATCCCCGG - Intergenic
926505186 2:13705437-13705459 GTATGCATAGTATGTGTATCAGG + Intergenic
931284697 2:60822174-60822196 GTCAGCATAGTATGTACCTCAGG + Intergenic
945181433 2:207095749-207095771 GTGTGTATTGTATGTTTCCAGGG - Intronic
945564714 2:211383167-211383189 GTGTGCATATTTAGCATCCCTGG - Exonic
946132765 2:217620094-217620116 GTGTGCATGGTAATTCTCCCAGG - Intronic
1176388734 21:6152567-6152589 GTGTGTGTGGTATGCATCCCTGG - Intergenic
1176389219 21:6155030-6155052 GTGTGGATAGTGAGGATCCCGGG - Intergenic
1178068285 21:28932033-28932055 GTGTGCACATTGTGTATCTCAGG - Intronic
1179734253 21:43383218-43383240 GTGTGGATAGTGAGGATCCCGGG + Intergenic
1179734738 21:43385681-43385703 GTGTGTGTGGTATGCATCCCTGG + Intergenic
1182205741 22:28623606-28623628 GTGTTCATGGTATATTTCCCAGG + Intronic
1182873021 22:33665031-33665053 GAGTGCTTGCTATGTATCCCAGG - Intronic
1182973119 22:34596266-34596288 GTATGAATAGTATGAATACCAGG + Intergenic
949174525 3:1043324-1043346 GGGTGCAAAGTATTTATCCTGGG - Intergenic
949253130 3:2011541-2011563 GTGTGCTCAGTACATATCCCAGG + Intergenic
957940753 3:87000574-87000596 GTGTGCATACTATGTCTCAAAGG + Intergenic
959948143 3:112149198-112149220 GAGTGCATAGTCTGAATGCCTGG + Intronic
960087618 3:113607800-113607822 GTTTGTATAGTATGAATCCTGGG - Intronic
962250880 3:133835418-133835440 GTGTGCATAGTGTGTGTCCTTGG + Intronic
962354716 3:134684010-134684032 GGGTGCATAGTAACAATCCCAGG + Intronic
962371001 3:134820678-134820700 GTGTGCACTGTAGGTAACCCAGG - Intronic
964808602 3:160638641-160638663 GTATGCAAAGTATTGATCCCGGG + Intergenic
968879468 4:3291927-3291949 GTGTGATTAGTTTGGATCCCAGG - Intergenic
970668450 4:18366430-18366452 GTGTGCATGGTCTGAATGCCTGG - Intergenic
980076773 4:128302276-128302298 GTGTTCAAAGTATGGGTCCCTGG + Intergenic
983755595 4:171330593-171330615 GTGTGGAAAGTGTGGATCCCCGG - Intergenic
985158614 4:187019987-187020009 GTGTGCATAGCAGATTTCCCAGG - Intergenic
993083322 5:83330246-83330268 CTTTGCATAGTATGAATTCCTGG - Intronic
993083404 5:83331529-83331551 CTTTGCATAGTATGAATTCCTGG - Intronic
994760310 5:103843795-103843817 GTGTGCATAATTTTTATTCCAGG + Intergenic
1002769355 6:277618-277640 AGGTGTATAGTATCTATCCCTGG + Intergenic
1007780176 6:44248080-44248102 GTGGGTATCGTATGGATCCCAGG + Intronic
1009372246 6:62920324-62920346 GTCTGCCTAGCATGGATCCCTGG - Intergenic
1009463016 6:63936493-63936515 CTGTGCATAGTCTGTTTCCATGG + Intronic
1011023525 6:82840733-82840755 ATGTGTATAGTATGTTTCCCTGG + Intergenic
1011708399 6:90026456-90026478 TTGTTCCTAGTATGTTTCCCAGG + Intronic
1015764741 6:136704421-136704443 GTGTCTATAGTATGTTTCCATGG - Intronic
1017966594 6:159272168-159272190 GTGTGCATAGTATGTATCCCTGG - Intergenic
1022220013 7:28304905-28304927 GTGTGCACAGTAATTATCTCCGG + Intronic
1041555594 8:59151094-59151116 GTGTACATATTATGTTTTCCTGG + Intergenic
1047643443 8:126845221-126845243 GTGTGTATAGTATGTATGTGGGG - Intergenic
1047742289 8:127816207-127816229 GTGTTCATAGTTTGGATCCTAGG - Intergenic
1062139267 9:134946731-134946753 GTGTGAATAGTCTGTATGTCTGG - Intergenic
1189384686 X:40527745-40527767 GTGTCCATGGTATGTGTCCATGG - Intergenic
1192343022 X:70279869-70279891 GTCTGCTTAGGTTGTATCCCAGG + Intronic
1193470334 X:81893448-81893470 GGGTGGATAGTACGTATCCTGGG + Intergenic
1196684393 X:118497642-118497664 GTGTGCAGAGCATTTATACCAGG + Intronic