ID: 1017966899

View in Genome Browser
Species Human (GRCh38)
Location 6:159274914-159274936
Sequence GTGAGCTACTACGCCCGGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017966899_1017966905 9 Left 1017966899 6:159274914-159274936 CCTAGCCGGGCGTAGTAGCTCAC No data
Right 1017966905 6:159274946-159274968 CCCAGAACTTTGGGAAGCCGAGG 0: 65
1: 6128
2: 137411
3: 280086
4: 208237
1017966899_1017966907 12 Left 1017966899 6:159274914-159274936 CCTAGCCGGGCGTAGTAGCTCAC No data
Right 1017966907 6:159274949-159274971 AGAACTTTGGGAAGCCGAGGTGG 0: 45
1: 4380
2: 103630
3: 195728
4: 133705
1017966899_1017966901 -1 Left 1017966899 6:159274914-159274936 CCTAGCCGGGCGTAGTAGCTCAC No data
Right 1017966901 6:159274936-159274958 CACCTGTAATCCCAGAACTTTGG 0: 1535
1: 75870
2: 213055
3: 254444
4: 203232
1017966899_1017966912 30 Left 1017966899 6:159274914-159274936 CCTAGCCGGGCGTAGTAGCTCAC No data
Right 1017966912 6:159274967-159274989 GGTGGGCGGATCATGAGGTCAGG 0: 2274
1: 16052
2: 51057
3: 62402
4: 49545
1017966899_1017966902 0 Left 1017966899 6:159274914-159274936 CCTAGCCGGGCGTAGTAGCTCAC No data
Right 1017966902 6:159274937-159274959 ACCTGTAATCCCAGAACTTTGGG 0: 1655
1: 81410
2: 314026
3: 244715
4: 145642
1017966899_1017966908 13 Left 1017966899 6:159274914-159274936 CCTAGCCGGGCGTAGTAGCTCAC No data
Right 1017966908 6:159274950-159274972 GAACTTTGGGAAGCCGAGGTGGG 0: 31
1: 2272
2: 49451
3: 206073
4: 277917
1017966899_1017966909 16 Left 1017966899 6:159274914-159274936 CCTAGCCGGGCGTAGTAGCTCAC No data
Right 1017966909 6:159274953-159274975 CTTTGGGAAGCCGAGGTGGGCGG 0: 1021
1: 32033
2: 118079
3: 162676
4: 169805
1017966899_1017966910 25 Left 1017966899 6:159274914-159274936 CCTAGCCGGGCGTAGTAGCTCAC No data
Right 1017966910 6:159274962-159274984 GCCGAGGTGGGCGGATCATGAGG 0: 1233
1: 10267
2: 40388
3: 58995
4: 60941

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017966899 Original CRISPR GTGAGCTACTACGCCCGGCT AGG (reversed) Intergenic
No off target data available for this crispr