ID: 1017967477

View in Genome Browser
Species Human (GRCh38)
Location 6:159279045-159279067
Sequence GGCATTACTAGAGGGAAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017967477_1017967483 4 Left 1017967477 6:159279045-159279067 CCATCCTTCCCTCTAGTAATGCC No data
Right 1017967483 6:159279072-159279094 AAGATTTCAACAGTGATACCAGG No data
1017967477_1017967485 14 Left 1017967477 6:159279045-159279067 CCATCCTTCCCTCTAGTAATGCC No data
Right 1017967485 6:159279082-159279104 CAGTGATACCAGGAGAAGGTTGG No data
1017967477_1017967484 10 Left 1017967477 6:159279045-159279067 CCATCCTTCCCTCTAGTAATGCC No data
Right 1017967484 6:159279078-159279100 TCAACAGTGATACCAGGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017967477 Original CRISPR GGCATTACTAGAGGGAAGGA TGG (reversed) Intergenic
No off target data available for this crispr