ID: 1017967480

View in Genome Browser
Species Human (GRCh38)
Location 6:159279054-159279076
Sequence ATCTTGGTTGGCATTACTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017967480_1017967483 -5 Left 1017967480 6:159279054-159279076 CCTCTAGTAATGCCAACCAAGAT No data
Right 1017967483 6:159279072-159279094 AAGATTTCAACAGTGATACCAGG No data
1017967480_1017967484 1 Left 1017967480 6:159279054-159279076 CCTCTAGTAATGCCAACCAAGAT No data
Right 1017967484 6:159279078-159279100 TCAACAGTGATACCAGGAGAAGG No data
1017967480_1017967485 5 Left 1017967480 6:159279054-159279076 CCTCTAGTAATGCCAACCAAGAT No data
Right 1017967485 6:159279082-159279104 CAGTGATACCAGGAGAAGGTTGG No data
1017967480_1017967487 24 Left 1017967480 6:159279054-159279076 CCTCTAGTAATGCCAACCAAGAT No data
Right 1017967487 6:159279101-159279123 TTGGAGAGCAAGAGAGACACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017967480 Original CRISPR ATCTTGGTTGGCATTACTAG AGG (reversed) Intergenic
No off target data available for this crispr