ID: 1017967481

View in Genome Browser
Species Human (GRCh38)
Location 6:159279066-159279088
Sequence ATCACTGTTGAAATCTTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017967481_1017967485 -7 Left 1017967481 6:159279066-159279088 CCAACCAAGATTTCAACAGTGAT No data
Right 1017967485 6:159279082-159279104 CAGTGATACCAGGAGAAGGTTGG No data
1017967481_1017967487 12 Left 1017967481 6:159279066-159279088 CCAACCAAGATTTCAACAGTGAT No data
Right 1017967487 6:159279101-159279123 TTGGAGAGCAAGAGAGACACCGG No data
1017967481_1017967488 26 Left 1017967481 6:159279066-159279088 CCAACCAAGATTTCAACAGTGAT No data
Right 1017967488 6:159279115-159279137 AGACACCGGAAGAGCCAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017967481 Original CRISPR ATCACTGTTGAAATCTTGGT TGG (reversed) Intergenic
No off target data available for this crispr