ID: 1017967483

View in Genome Browser
Species Human (GRCh38)
Location 6:159279072-159279094
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017967479_1017967483 -4 Left 1017967479 6:159279053-159279075 CCCTCTAGTAATGCCAACCAAGA No data
Right 1017967483 6:159279072-159279094 AAGATTTCAACAGTGATACCAGG No data
1017967480_1017967483 -5 Left 1017967480 6:159279054-159279076 CCTCTAGTAATGCCAACCAAGAT No data
Right 1017967483 6:159279072-159279094 AAGATTTCAACAGTGATACCAGG No data
1017967477_1017967483 4 Left 1017967477 6:159279045-159279067 CCATCCTTCCCTCTAGTAATGCC No data
Right 1017967483 6:159279072-159279094 AAGATTTCAACAGTGATACCAGG No data
1017967478_1017967483 0 Left 1017967478 6:159279049-159279071 CCTTCCCTCTAGTAATGCCAACC No data
Right 1017967483 6:159279072-159279094 AAGATTTCAACAGTGATACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017967483 Original CRISPR AAGATTTCAACAGTGATACC AGG Intergenic
No off target data available for this crispr