ID: 1017967487

View in Genome Browser
Species Human (GRCh38)
Location 6:159279101-159279123
Sequence TTGGAGAGCAAGAGAGACAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017967480_1017967487 24 Left 1017967480 6:159279054-159279076 CCTCTAGTAATGCCAACCAAGAT No data
Right 1017967487 6:159279101-159279123 TTGGAGAGCAAGAGAGACACCGG No data
1017967479_1017967487 25 Left 1017967479 6:159279053-159279075 CCCTCTAGTAATGCCAACCAAGA No data
Right 1017967487 6:159279101-159279123 TTGGAGAGCAAGAGAGACACCGG No data
1017967481_1017967487 12 Left 1017967481 6:159279066-159279088 CCAACCAAGATTTCAACAGTGAT No data
Right 1017967487 6:159279101-159279123 TTGGAGAGCAAGAGAGACACCGG No data
1017967482_1017967487 8 Left 1017967482 6:159279070-159279092 CCAAGATTTCAACAGTGATACCA No data
Right 1017967487 6:159279101-159279123 TTGGAGAGCAAGAGAGACACCGG No data
1017967478_1017967487 29 Left 1017967478 6:159279049-159279071 CCTTCCCTCTAGTAATGCCAACC No data
Right 1017967487 6:159279101-159279123 TTGGAGAGCAAGAGAGACACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017967487 Original CRISPR TTGGAGAGCAAGAGAGACAC CGG Intergenic
No off target data available for this crispr