ID: 1017969409

View in Genome Browser
Species Human (GRCh38)
Location 6:159298802-159298824
Sequence AGCCTCCCTCCCGCTCCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017969403_1017969409 1 Left 1017969403 6:159298778-159298800 CCTCATGGCTACCACCTCCCTCA No data
Right 1017969409 6:159298802-159298824 AGCCTCCCTCCCGCTCCCCTGGG No data
1017969402_1017969409 8 Left 1017969402 6:159298771-159298793 CCTGAAGCCTCATGGCTACCACC No data
Right 1017969409 6:159298802-159298824 AGCCTCCCTCCCGCTCCCCTGGG No data
1017969404_1017969409 -10 Left 1017969404 6:159298789-159298811 CCACCTCCCTCAGAGCCTCCCTC No data
Right 1017969409 6:159298802-159298824 AGCCTCCCTCCCGCTCCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017969409 Original CRISPR AGCCTCCCTCCCGCTCCCCT GGG Intergenic
No off target data available for this crispr