ID: 1017970267

View in Genome Browser
Species Human (GRCh38)
Location 6:159306299-159306321
Sequence TTTCTATTGTTTCCCATCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017970267_1017970274 13 Left 1017970267 6:159306299-159306321 CCAGGGATGGGAAACAATAGAAA No data
Right 1017970274 6:159306335-159306357 ACAGGTTACTGGCGCAGGAAGGG No data
1017970267_1017970270 2 Left 1017970267 6:159306299-159306321 CCAGGGATGGGAAACAATAGAAA No data
Right 1017970270 6:159306324-159306346 ACTATAAAACCACAGGTTACTGG No data
1017970267_1017970268 -5 Left 1017970267 6:159306299-159306321 CCAGGGATGGGAAACAATAGAAA No data
Right 1017970268 6:159306317-159306339 AGAAACCACTATAAAACCACAGG No data
1017970267_1017970271 8 Left 1017970267 6:159306299-159306321 CCAGGGATGGGAAACAATAGAAA No data
Right 1017970271 6:159306330-159306352 AAACCACAGGTTACTGGCGCAGG No data
1017970267_1017970273 12 Left 1017970267 6:159306299-159306321 CCAGGGATGGGAAACAATAGAAA No data
Right 1017970273 6:159306334-159306356 CACAGGTTACTGGCGCAGGAAGG No data
1017970267_1017970275 20 Left 1017970267 6:159306299-159306321 CCAGGGATGGGAAACAATAGAAA No data
Right 1017970275 6:159306342-159306364 ACTGGCGCAGGAAGGGACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017970267 Original CRISPR TTTCTATTGTTTCCCATCCC TGG (reversed) Intergenic
No off target data available for this crispr