ID: 1017970435

View in Genome Browser
Species Human (GRCh38)
Location 6:159307804-159307826
Sequence CAATGGAATCTTGTTATTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017970435_1017970441 10 Left 1017970435 6:159307804-159307826 CCCAGAATAACAAGATTCCATTG No data
Right 1017970441 6:159307837-159307859 CTCACTAATTATGCTGTCTGGGG No data
1017970435_1017970439 8 Left 1017970435 6:159307804-159307826 CCCAGAATAACAAGATTCCATTG No data
Right 1017970439 6:159307835-159307857 CACTCACTAATTATGCTGTCTGG No data
1017970435_1017970440 9 Left 1017970435 6:159307804-159307826 CCCAGAATAACAAGATTCCATTG No data
Right 1017970440 6:159307836-159307858 ACTCACTAATTATGCTGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017970435 Original CRISPR CAATGGAATCTTGTTATTCT GGG (reversed) Intergenic
No off target data available for this crispr