ID: 1017970437

View in Genome Browser
Species Human (GRCh38)
Location 6:159307821-159307843
Sequence TAGTGAGTGGCAAAGTACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017970437_1017970441 -7 Left 1017970437 6:159307821-159307843 CCATTGTACTTTGCCACTCACTA No data
Right 1017970441 6:159307837-159307859 CTCACTAATTATGCTGTCTGGGG No data
1017970437_1017970440 -8 Left 1017970437 6:159307821-159307843 CCATTGTACTTTGCCACTCACTA No data
Right 1017970440 6:159307836-159307858 ACTCACTAATTATGCTGTCTGGG No data
1017970437_1017970445 29 Left 1017970437 6:159307821-159307843 CCATTGTACTTTGCCACTCACTA No data
Right 1017970445 6:159307873-159307895 TTCCGTACATTTCAGCTTCATGG No data
1017970437_1017970439 -9 Left 1017970437 6:159307821-159307843 CCATTGTACTTTGCCACTCACTA No data
Right 1017970439 6:159307835-159307857 CACTCACTAATTATGCTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017970437 Original CRISPR TAGTGAGTGGCAAAGTACAA TGG (reversed) Intergenic
No off target data available for this crispr