ID: 1017970439

View in Genome Browser
Species Human (GRCh38)
Location 6:159307835-159307857
Sequence CACTCACTAATTATGCTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017970436_1017970439 7 Left 1017970436 6:159307805-159307827 CCAGAATAACAAGATTCCATTGT No data
Right 1017970439 6:159307835-159307857 CACTCACTAATTATGCTGTCTGG No data
1017970437_1017970439 -9 Left 1017970437 6:159307821-159307843 CCATTGTACTTTGCCACTCACTA No data
Right 1017970439 6:159307835-159307857 CACTCACTAATTATGCTGTCTGG No data
1017970435_1017970439 8 Left 1017970435 6:159307804-159307826 CCCAGAATAACAAGATTCCATTG No data
Right 1017970439 6:159307835-159307857 CACTCACTAATTATGCTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017970439 Original CRISPR CACTCACTAATTATGCTGTC TGG Intergenic
No off target data available for this crispr