ID: 1017971368

View in Genome Browser
Species Human (GRCh38)
Location 6:159315276-159315298
Sequence CTGCCTGGAAGGAGCTCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017971355_1017971368 25 Left 1017971355 6:159315228-159315250 CCCTGGGAGCGTCGTGGGGCTGT No data
Right 1017971368 6:159315276-159315298 CTGCCTGGAAGGAGCTCCCCAGG No data
1017971352_1017971368 30 Left 1017971352 6:159315223-159315245 CCTGTCCCTGGGAGCGTCGTGGG No data
Right 1017971368 6:159315276-159315298 CTGCCTGGAAGGAGCTCCCCAGG No data
1017971356_1017971368 24 Left 1017971356 6:159315229-159315251 CCTGGGAGCGTCGTGGGGCTGTG No data
Right 1017971368 6:159315276-159315298 CTGCCTGGAAGGAGCTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017971368 Original CRISPR CTGCCTGGAAGGAGCTCCCC AGG Intergenic
No off target data available for this crispr