ID: 1017973983

View in Genome Browser
Species Human (GRCh38)
Location 6:159338224-159338246
Sequence GTGTGTGCAGGCACCTGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017973983_1017973987 0 Left 1017973983 6:159338224-159338246 CCACAGCAGGTGCCTGCACACAC No data
Right 1017973987 6:159338247-159338269 CATCAAGAGGCCTGAGTAAAAGG No data
1017973983_1017973989 13 Left 1017973983 6:159338224-159338246 CCACAGCAGGTGCCTGCACACAC No data
Right 1017973989 6:159338260-159338282 GAGTAAAAGGCCACCCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017973983 Original CRISPR GTGTGTGCAGGCACCTGCTG TGG (reversed) Intergenic
No off target data available for this crispr