ID: 1017977115

View in Genome Browser
Species Human (GRCh38)
Location 6:159368047-159368069
Sequence GACAGTTCTTGGTTTGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017977115_1017977122 16 Left 1017977115 6:159368047-159368069 CCAGTAACAAACCAAGAACTGTC No data
Right 1017977122 6:159368086-159368108 GTTATCTGCAGAAGATGGCTGGG No data
1017977115_1017977121 15 Left 1017977115 6:159368047-159368069 CCAGTAACAAACCAAGAACTGTC No data
Right 1017977121 6:159368085-159368107 AGTTATCTGCAGAAGATGGCTGG 0: 185
1: 187
2: 104
3: 111
4: 225
1017977115_1017977120 11 Left 1017977115 6:159368047-159368069 CCAGTAACAAACCAAGAACTGTC No data
Right 1017977120 6:159368081-159368103 GAGTAGTTATCTGCAGAAGATGG 0: 178
1: 192
2: 102
3: 110
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017977115 Original CRISPR GACAGTTCTTGGTTTGTTAC TGG (reversed) Intergenic
No off target data available for this crispr