ID: 1017979298

View in Genome Browser
Species Human (GRCh38)
Location 6:159385571-159385593
Sequence AGCCCAGAAGCAACTGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017979298_1017979300 2 Left 1017979298 6:159385571-159385593 CCCTCTGCAGTTGCTTCTGGGCT No data
Right 1017979300 6:159385596-159385618 CTCATTCACAATCCTACCATTGG No data
1017979298_1017979301 10 Left 1017979298 6:159385571-159385593 CCCTCTGCAGTTGCTTCTGGGCT No data
Right 1017979301 6:159385604-159385626 CAATCCTACCATTGGCCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017979298 Original CRISPR AGCCCAGAAGCAACTGCAGA GGG (reversed) Intergenic
No off target data available for this crispr