ID: 1017981080

View in Genome Browser
Species Human (GRCh38)
Location 6:159401643-159401665
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 3, 1: 2, 2: 5, 3: 16, 4: 161}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017981080_1017981087 26 Left 1017981080 6:159401643-159401665 CCTGGGTTGGCCACTCCTGGATT 0: 3
1: 2
2: 5
3: 16
4: 161
Right 1017981087 6:159401692-159401714 TCCAGGTGTGTCTGCCATGCAGG No data
1017981080_1017981086 9 Left 1017981080 6:159401643-159401665 CCTGGGTTGGCCACTCCTGGATT 0: 3
1: 2
2: 5
3: 16
4: 161
Right 1017981086 6:159401675-159401697 GGAACTCTGAACACACATCCAGG No data
1017981080_1017981089 27 Left 1017981080 6:159401643-159401665 CCTGGGTTGGCCACTCCTGGATT 0: 3
1: 2
2: 5
3: 16
4: 161
Right 1017981089 6:159401693-159401715 CCAGGTGTGTCTGCCATGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017981080 Original CRISPR AATCCAGGAGTGGCCAACCC AGG (reversed) Intergenic
900415218 1:2531619-2531641 AATCCAGGAGTGGGGTTCCCTGG + Intergenic
900703811 1:4063601-4063623 ACTGCAGGAGGGGCCAGCCCGGG + Intergenic
902336053 1:15755656-15755678 AACCGAGGGGTTGCCAACCCAGG - Intergenic
902384551 1:16068866-16068888 AATCCAGCAGAGGCCAATCTGGG - Intronic
902968766 1:20031590-20031612 ATTCCAGAAGTTGCCAATCCAGG - Intronic
903356749 1:22753179-22753201 AATCCAGGGTTGCCCAACTCTGG - Intronic
903676752 1:25069154-25069176 AATCCAGGAGTGGCTGATTCTGG + Intergenic
904058180 1:27686060-27686082 AATCCAGGAGTTTCCACCCTGGG - Intergenic
905112765 1:35609166-35609188 ACTCCAAGAGTGGACAAACCTGG + Intronic
907276578 1:53320184-53320206 AATCCAGAAGTGGGCAAGCAGGG + Intronic
911151144 1:94597774-94597796 AATCTAGGTCTGGCCAGCCCTGG - Intergenic
911618042 1:100036830-100036852 ATTCCAGGAGTGGCTAAGCTAGG + Intergenic
911705114 1:101002215-101002237 AACCCACAAGTGGCCCACCCAGG + Intronic
911766840 1:101687229-101687251 AATCCAGGAGTACCCTACTCTGG - Intergenic
913177655 1:116289645-116289667 AATTCAGGGGTGGCCAGACCTGG + Intergenic
916510675 1:165469992-165470014 ACTCCAGGAGTGGCAAGGCCTGG + Intergenic
918824769 1:189309975-189309997 AATCCAGGGGTCCTCAACCCGGG - Intergenic
919248499 1:195020237-195020259 AATTCAGGAGTGTTCAATCCAGG + Intergenic
919931600 1:202224798-202224820 AGTCCAGGGGTCCCCAACCCGGG - Intronic
919977585 1:202622988-202623010 AATCCAGGAGTTGACAACTCAGG - Intronic
922128612 1:222754655-222754677 AATCCAGGAGTGGCTTAGCTGGG - Intergenic
922401881 1:225267876-225267898 AATCCAGGTATGGCCCACCAGGG + Intronic
1064057087 10:12106771-12106793 AACCCAAGAGTGGGCATCCCTGG - Intronic
1065298823 10:24302313-24302335 AATCCAGGAGTGGCCAACCCAGG - Intronic
1065673759 10:28152227-28152249 AATCCAGGAGTGGGCAGGCTAGG - Intronic
1067419782 10:46135188-46135210 ACTCCAGGATTTGCCCACCCTGG - Intergenic
1067426236 10:46214223-46214245 ACTCCAGGATTTGCCCACCCTGG + Intergenic
1067505132 10:46841785-46841807 ACTCCAGGATTTGCCCACCCTGG - Intergenic
1067844406 10:49708548-49708570 GATCCAGGCCTGGCCAACCCAGG - Exonic
1069357315 10:67601539-67601561 AAGCCAGGGGTCCCCAACCCTGG - Intronic
1069894969 10:71674861-71674883 ACACCAGGTGTGGCCATCCCAGG - Intronic
1073179012 10:101572885-101572907 AATCCAGGTGTTGCCAGCCTGGG + Intronic
1074063984 10:109995712-109995734 AATCCAAGAGTGGCCAAATCAGG - Intergenic
1077112834 11:869472-869494 AATCCAGGAGTGGGCGAGTCCGG + Exonic
1077147274 11:1051869-1051891 GGTCCAGGAGTGGAGAACCCAGG - Intergenic
1081814285 11:45929826-45929848 AAGACAGGAGTGGGCAGCCCTGG - Intronic
1083083961 11:60123567-60123589 AATCTAGGAATGGCCAACCTGGG + Intergenic
1083460023 11:62805157-62805179 AATCCAGGAGTCAACAACTCGGG + Intronic
1083718052 11:64590547-64590569 AATCCACCAGGGGCCAAGCCTGG - Intergenic
1083889908 11:65590521-65590543 GATCCAGGAGTGGTTCACCCTGG + Exonic
1083895001 11:65615589-65615611 GACCCAGGCGTTGCCAACCCAGG - Intronic
1090591097 11:128269981-128270003 AATTCAGGGGTTCCCAACCCTGG + Intergenic
1091993571 12:4975594-4975616 CATCCTGGAGAGGCCAACCAAGG - Intergenic
1100979107 12:100150856-100150878 AATCCACTTGTGGCCAAGCCAGG + Intergenic
1103152716 12:118655307-118655329 AATCCAGGAGTGGCTTCTCCAGG - Intergenic
1103403884 12:120661249-120661271 AAGCCAGCAGTGGCCATCCATGG + Intronic
1105630247 13:22156682-22156704 AATCCAGCAGTCCCCAAACCTGG - Intergenic
1105650736 13:22374195-22374217 TTTCCAGGAGAGGCCAGCCCTGG - Intergenic
1106433577 13:29704959-29704981 AATCCAGGATTGGCAGAGCCGGG + Intergenic
1112432537 13:99363490-99363512 AGTCCAGCAGTGGGCAGCCCAGG + Intronic
1115419685 14:33180290-33180312 AATTCAGAAGTGGCGAACCAAGG - Intronic
1117565009 14:56985009-56985031 AATCAATGAGTGGCAAAGCCAGG + Intergenic
1117714911 14:58570689-58570711 AGTCCAGGTTTGGGCAACCCAGG - Intergenic
1120772999 14:88401621-88401643 AGGCCAGGAGTGGCCAGCCTGGG + Intronic
1122600179 14:102917485-102917507 AATCTAGGAATGGCCTGCCCAGG + Intergenic
1122822820 14:104355612-104355634 AGTGCAGGAGAGACCAACCCCGG - Intergenic
1123122189 14:105921837-105921859 AGTGCAGGAGTGGCCAAAGCTGG - Intronic
1123404853 15:20013402-20013424 AGTGCAGGAGTGGCCAAAGCTGG - Intergenic
1123514184 15:21020050-21020072 AGTGCAGGAGTGGCCAAAGCTGG - Intergenic
1124493236 15:30171357-30171379 AATCCAGGAATTGACAACTCAGG - Intergenic
1124750298 15:32366968-32366990 AATCCAGGAATTGACAACTCAGG + Intergenic
1125754557 15:42054155-42054177 ATTCTAGGAGTGGCCAACTGTGG - Intergenic
1126089865 15:45041704-45041726 ATTCCAGAAGTGGCCAAACGAGG + Intronic
1126890397 15:53198546-53198568 ATTCCAGGGGCTGCCAACCCAGG - Intergenic
1132946658 16:2535368-2535390 AATCCAGAAGGGGCCATTCCTGG - Intergenic
1132946730 16:2535887-2535909 AATCCAGGAGAGGCCAGGCTGGG - Intergenic
1132969044 16:2676243-2676265 AATCCAGAAGGGGCCATTCCTGG + Intergenic
1134176380 16:12010010-12010032 AACCCAGAACTGGCAAACCCAGG - Intronic
1135774690 16:25246621-25246643 AGACCAGAAGTGGCCAAACCCGG - Intronic
1135945074 16:26858276-26858298 AATCTGGGAGTGGCCAAGCAGGG - Intergenic
1137512647 16:49115086-49115108 TATCCAGGACTGGCCAAAGCAGG + Intergenic
1138572534 16:57884847-57884869 ACTCCAGGAGTGCCCACCCCTGG - Intronic
1138694198 16:58796406-58796428 AATGCAGGGGTCGCCAGCCCTGG + Intergenic
1138997300 16:62471747-62471769 AATCCAGGAGTGCCAAGCCATGG - Intergenic
1140054658 16:71515609-71515631 AATACAGGAGTGACCAGCCTGGG + Intronic
1141539056 16:84704831-84704853 ATTCCAGGAGAGGGCAACCAGGG - Exonic
1141756748 16:85996458-85996480 AAATCAGGAGTGGCAAATCCCGG + Intergenic
1143001741 17:3799021-3799043 AATCCAGGACTGGCCTGGCCTGG - Intronic
1144444817 17:15317102-15317124 AATCCTGGAGAAGCCATCCCGGG + Intronic
1146596932 17:34177418-34177440 AACACAGGAGTGGGCACCCCAGG - Intergenic
1147561518 17:41512368-41512390 CATCCCGGAATGCCCAACCCAGG + Intergenic
1148755776 17:49972268-49972290 GATCCAGGAGTGGCCCCGCCGGG + Intronic
1150826604 17:68481597-68481619 AATGCAGGGGTACCCAACCCTGG - Intergenic
1151492989 17:74443662-74443684 AACCCAGGAGTGGCCAACTTGGG - Intronic
1154194390 18:12254881-12254903 CTTCCAGGAGGGGCCAAGCCTGG - Intronic
1160826676 19:1083372-1083394 AAGCCCCGAGTGGCCAGCCCCGG - Intronic
1165069815 19:33248797-33248819 GAGCCAGGAGGGACCAACCCAGG + Intergenic
1166326282 19:42053058-42053080 AATGCAGGAGTGGCACCCCCAGG + Intronic
1166777072 19:45319520-45319542 CAGACAGGAGTGGACAACCCAGG - Exonic
1166964840 19:46523027-46523049 AATCCAGGAGACCTCAACCCAGG + Intronic
928117819 2:28560143-28560165 TACCAAGGAGTGGCCCACCCTGG - Intronic
929435353 2:41924702-41924724 AGGCCAGGAGAGGCCAACCCAGG - Intergenic
930004135 2:46882526-46882548 AATCCTGCTCTGGCCAACCCCGG - Intergenic
930501226 2:52220777-52220799 AATGAAGGAGTGGCCCACCTTGG + Intergenic
933224153 2:79726319-79726341 AATGCAGAAGTCCCCAACCCCGG + Intronic
933559276 2:83872071-83872093 GATCCAGGAGTGGCCAACCCAGG + Intergenic
937524428 2:122749656-122749678 AATGCAGGAAGGGCCAACACAGG + Intergenic
938614818 2:132986898-132986920 AATCCAGGAGTGGACAATCCAGG + Intronic
938821541 2:134965390-134965412 AATCCAGGAGTGCCCAAAACGGG - Intronic
942960840 2:181828510-181828532 AATCCGGAAGTGGCCAACTCAGG - Intergenic
943985500 2:194612593-194612615 AAGCCAAGATTGGACAACCCTGG + Intergenic
944591199 2:201219378-201219400 AACCCAGGAGTGGATAACACTGG + Exonic
946244942 2:218382131-218382153 AAGGCAGAAGTGGCCAGCCCTGG - Exonic
948703743 2:239777007-239777029 AATACAGGCATGGACAACCCGGG + Intronic
1172281648 20:33712053-33712075 AATTCAGGAATGGCAAACTCAGG + Intronic
1172636271 20:36411992-36412014 AATCCTGGAGTGTCGAAGCCAGG - Intronic
1173807553 20:45935576-45935598 AATCCGGGTCTGTCCAACCCAGG + Intronic
1173982102 20:47232479-47232501 AACCCAGGAGTGGCCAGCCTGGG + Intronic
1178391947 21:32205998-32206020 AAACAAGGAGTGGCCAGCCAGGG - Intergenic
1179166998 21:38943175-38943197 CATCCAAGAGTGGGCGACCCAGG - Intergenic
1181874910 22:25932724-25932746 AATCCAGGAGTTGGCAAACTAGG + Intronic
1182422766 22:30256563-30256585 GACCCAGGACTGGCCCACCCCGG + Intergenic
1182635541 22:31723851-31723873 AATGCAGCAGTCCCCAACCCTGG + Intronic
1183355375 22:37356058-37356080 AATCCAGGAGGGAGCAACCGGGG + Intergenic
1184262164 22:43324652-43324674 TATCCAGGAGTCGCCGCCCCTGG + Intronic
1185348451 22:50320966-50320988 AACCTTGGCGTGGCCAACCCTGG - Intronic
949524317 3:4888397-4888419 AATCCAGTAGTTCCCAAACCTGG + Intergenic
950142882 3:10627470-10627492 AACCCAGGACTGGCTAACCCAGG - Intronic
950374553 3:12560007-12560029 AATCCAGAACTGCCCAACCCTGG - Intronic
953365326 3:42339759-42339781 AAGCCAGGAGTGGGCAAAGCAGG - Intergenic
953826188 3:46252963-46252985 AGTCCAGGAGTTGTCAACCTTGG + Intronic
956314249 3:67916351-67916373 AATCCAGGAATGACAAATCCAGG + Intergenic
960628309 3:119702914-119702936 AAAGCAGGAGTGGCCAGGCCAGG - Intergenic
962528730 3:136258868-136258890 AATCAAGGAGAAGACAACCCAGG - Intronic
966712724 3:182986014-182986036 CATCTAGGAGTGGCCAAGCTGGG - Intergenic
970034937 4:11722611-11722633 AATCCGGGAGTGGCTTACCTAGG - Intergenic
970962671 4:21891118-21891140 AATGCAAGAGTGTTCAACCCAGG - Intronic
970962677 4:21891174-21891196 AATCCAAGAGTGGTCAACCCAGG - Intronic
971402416 4:26288212-26288234 AATCCAGGAGTGGCTTAGCTGGG + Intronic
973664549 4:53144857-53144879 AGGCCAGGGGTCGCCAACCCTGG + Intronic
975712295 4:77172962-77172984 AAACAATGAGTGGCCAAACCAGG - Intronic
975719177 4:77233846-77233868 AATCCAAGAGTGGCCAACCTGGG + Intronic
978651377 4:111009795-111009817 AATGCAGGAGTCTCTAACCCCGG + Intergenic
978836045 4:113150582-113150604 AATCCAGGGATGGCCAAAGCAGG + Intronic
978850422 4:113329532-113329554 ATTTCAGGAGTGGGAAACCCTGG - Intronic
981141739 4:141277441-141277463 AATCCTGGAGTGGCTCACCTGGG + Intergenic
983905126 4:173173668-173173690 AATGCAGGGGTCCCCAACCCTGG - Intronic
985520428 5:371637-371659 AGTCCAGGACTGGTCAGCCCAGG - Intronic
986557960 5:9030345-9030367 AATCCAGGAGTCGCCTCACCAGG + Intergenic
987211648 5:15689826-15689848 AATCCAGGTTTGTCCAAACCAGG + Intronic
988813631 5:34809032-34809054 AAAACAGGAGTACCCAACCCAGG - Intronic
991245252 5:64503469-64503491 AACTCAGGAGCGGCCAACTCAGG + Intergenic
995843765 5:116470736-116470758 AAACCAGAACTGCCCAACCCAGG - Intronic
999340300 5:150764484-150764506 AGTCCAGGAGTTGCTAACCTGGG - Intergenic
999845061 5:155470213-155470235 AATCTGGGAGTGGCCAACCCAGG - Intergenic
1001947606 5:175793432-175793454 AATCTAGGAGTGCACAACTCTGG - Intergenic
1004699441 6:18065353-18065375 AAACCAGGGGTCCCCAACCCTGG + Intergenic
1008423203 6:51327150-51327172 GATCCAGGCCTGGCCAACCATGG + Intergenic
1009900469 6:69802725-69802747 AGTCTAGAAGTGGCCAACCCAGG - Intergenic
1017981080 6:159401643-159401665 AATCCAGGAGTGGCCAACCCAGG - Intergenic
1023112385 7:36826778-36826800 GATCCAGGACTGGCCAAGCAAGG - Intergenic
1024728741 7:52231059-52231081 AATACAGGAGTCCCCAACCCTGG - Intergenic
1025251122 7:57352289-57352311 AGCCAAGGAGTGGCCAAGCCTGG + Intergenic
1025757737 7:64360571-64360593 ACCCCAGGAGTCTCCAACCCAGG - Intergenic
1026036425 7:66833228-66833250 TCTCCAGGGGTGGCCAAGCCAGG + Intergenic
1026037494 7:66840140-66840162 TCTCCAGGGGTGGCCAAGCCAGG + Intergenic
1026068222 7:67094786-67094808 GATCCAGGAGTGGCCAACCTGGG + Intronic
1026708699 7:72717528-72717550 GATCCAGGAGTGGCCAACCCGGG - Intronic
1027885858 7:83904106-83904128 AATCCAGGCACTGCCAACCCAGG + Intergenic
1029174670 7:98656101-98656123 AACCCAGGAGTGTCCAGGCCTGG - Intergenic
1030128864 7:106179892-106179914 AAGCCAGGAGGGTCCCACCCAGG - Intergenic
1030715144 7:112800704-112800726 AATCCAGGAGTGGCCAACCCAGG - Intergenic
1031228563 7:119074537-119074559 AAGCCAGGCGTCCCCAACCCCGG + Intergenic
1032785782 7:135198210-135198232 ATGCCAGGAGTGGTCAGCCCTGG + Intronic
1033962118 7:146928069-146928091 ATACCAGGAGTAGCCAGCCCAGG - Intronic
1036130799 8:6107990-6108012 AATCCAAGTGTGGCTAACCTAGG - Intergenic
1041212980 8:55571482-55571504 AAACCAGGGGTCCCCAACCCTGG + Intergenic
1044842270 8:96346585-96346607 GTATCAGGAGTGGCCAACCCTGG + Intergenic
1045380244 8:101616708-101616730 GATCCAGCAGTGACCAACACAGG - Intronic
1047997464 8:130350308-130350330 AATTCAGGGCTGCCCAACCCAGG - Intronic
1049961061 9:738571-738593 AATTCAGGAGTGGCTCAACCAGG - Intronic
1052384388 9:27807082-27807104 ATTCCAGAAGTTGCCAATCCAGG - Intergenic
1053283560 9:36836714-36836736 TATGCAGGAGTGCCCAAGCCAGG - Exonic
1055402652 9:75941084-75941106 AATGCAGCAGTGGCCTACACAGG - Intronic
1056451319 9:86719756-86719778 AATTCAGGAGTGGCTTAACCGGG + Intergenic
1057088507 9:92234491-92234513 ACTCCAGGACTGGCCATTCCTGG - Intronic
1057806357 9:98222572-98222594 AGTCCAGGCGTGGCCCTCCCTGG - Intronic
1058056932 9:100458021-100458043 AATCAAGGAATGGGGAACCCAGG + Intronic
1060814041 9:126625586-126625608 CAGCCGGGAATGGCCAACCCTGG - Intronic
1062234898 9:135503089-135503111 AGGGCAGGAGTGGCCAAGCCTGG - Intronic
1062560802 9:137141035-137141057 AATCCAGGAGGGGCCATTCCTGG + Intronic
1188029946 X:25253155-25253177 AATACAAGAGTGACCAACACAGG - Intergenic
1190384795 X:49874805-49874827 AAACCAGGGGTCTCCAACCCGGG + Intergenic
1198547384 X:137707031-137707053 AATGCAGGAGTGGACTACCCAGG - Intergenic
1202114680 Y:21460027-21460049 AATCCAACAGTGGCTAACCACGG - Intergenic
1202353236 Y:24017287-24017309 AAACCAGAAGTGGCCACCCAAGG + Intergenic
1202517543 Y:25652828-25652850 AAACCAGAAGTGGCCACCCAAGG - Intergenic