ID: 1017982529

View in Genome Browser
Species Human (GRCh38)
Location 6:159413572-159413594
Sequence CCATCTTCAGATGTGGTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017982525_1017982529 13 Left 1017982525 6:159413536-159413558 CCTATTGAGAGAAGATCGTACAG No data
Right 1017982529 6:159413572-159413594 CCATCTTCAGATGTGGTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017982529 Original CRISPR CCATCTTCAGATGTGGTGCA AGG Intergenic
No off target data available for this crispr