ID: 1017983458

View in Genome Browser
Species Human (GRCh38)
Location 6:159422483-159422505
Sequence AGAGATAAGACTGCGTGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017983458_1017983462 -5 Left 1017983458 6:159422483-159422505 CCCCCACACGCAGTCTTATCTCT No data
Right 1017983462 6:159422501-159422523 TCTCTGAATGACTCATGCCATGG No data
1017983458_1017983463 -4 Left 1017983458 6:159422483-159422505 CCCCCACACGCAGTCTTATCTCT No data
Right 1017983463 6:159422502-159422524 CTCTGAATGACTCATGCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017983458 Original CRISPR AGAGATAAGACTGCGTGTGG GGG (reversed) Intergenic
No off target data available for this crispr