ID: 1017983846

View in Genome Browser
Species Human (GRCh38)
Location 6:159425383-159425405
Sequence GTCCTTCCCCTGCACATGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017983835_1017983846 29 Left 1017983835 6:159425331-159425353 CCAGAGAGGCCCCCAGCTCTCTG No data
Right 1017983846 6:159425383-159425405 GTCCTTCCCCTGCACATGAGAGG No data
1017983839_1017983846 17 Left 1017983839 6:159425343-159425365 CCAGCTCTCTGTATCTTAACTCC No data
Right 1017983846 6:159425383-159425405 GTCCTTCCCCTGCACATGAGAGG No data
1017983845_1017983846 -4 Left 1017983845 6:159425364-159425386 CCACAGAGGAGGAGTTGGGGTCC No data
Right 1017983846 6:159425383-159425405 GTCCTTCCCCTGCACATGAGAGG No data
1017983837_1017983846 19 Left 1017983837 6:159425341-159425363 CCCCAGCTCTCTGTATCTTAACT No data
Right 1017983846 6:159425383-159425405 GTCCTTCCCCTGCACATGAGAGG No data
1017983838_1017983846 18 Left 1017983838 6:159425342-159425364 CCCAGCTCTCTGTATCTTAACTC No data
Right 1017983846 6:159425383-159425405 GTCCTTCCCCTGCACATGAGAGG No data
1017983836_1017983846 20 Left 1017983836 6:159425340-159425362 CCCCCAGCTCTCTGTATCTTAAC No data
Right 1017983846 6:159425383-159425405 GTCCTTCCCCTGCACATGAGAGG No data
1017983834_1017983846 30 Left 1017983834 6:159425330-159425352 CCCAGAGAGGCCCCCAGCTCTCT No data
Right 1017983846 6:159425383-159425405 GTCCTTCCCCTGCACATGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017983846 Original CRISPR GTCCTTCCCCTGCACATGAG AGG Intergenic
No off target data available for this crispr