ID: 1017984329

View in Genome Browser
Species Human (GRCh38)
Location 6:159429901-159429923
Sequence GAGTGTGACCAGAGGGAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017984329_1017984340 22 Left 1017984329 6:159429901-159429923 CCAACTTCCCTCTGGTCACACTC No data
Right 1017984340 6:159429946-159429968 CCTGCTACCTATCCTTGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017984329 Original CRISPR GAGTGTGACCAGAGGGAAGT TGG (reversed) Intergenic
No off target data available for this crispr