ID: 1017984576

View in Genome Browser
Species Human (GRCh38)
Location 6:159432393-159432415
Sequence CTCTATCTCTTGATGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017984573_1017984576 3 Left 1017984573 6:159432367-159432389 CCATATTCAAAGGTAGGGTACAT No data
Right 1017984576 6:159432393-159432415 CTCTATCTCTTGATGGAAGAGGG No data
1017984569_1017984576 8 Left 1017984569 6:159432362-159432384 CCCACCCATATTCAAAGGTAGGG No data
Right 1017984576 6:159432393-159432415 CTCTATCTCTTGATGGAAGAGGG No data
1017984571_1017984576 7 Left 1017984571 6:159432363-159432385 CCACCCATATTCAAAGGTAGGGT No data
Right 1017984576 6:159432393-159432415 CTCTATCTCTTGATGGAAGAGGG No data
1017984572_1017984576 4 Left 1017984572 6:159432366-159432388 CCCATATTCAAAGGTAGGGTACA No data
Right 1017984576 6:159432393-159432415 CTCTATCTCTTGATGGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017984576 Original CRISPR CTCTATCTCTTGATGGAAGA GGG Intergenic
No off target data available for this crispr