ID: 1017986051

View in Genome Browser
Species Human (GRCh38)
Location 6:159444078-159444100
Sequence GAAGAGACCCAGTACCCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017986051_1017986055 3 Left 1017986051 6:159444078-159444100 CCCTGTGGGTACTGGGTCTCTTC No data
Right 1017986055 6:159444104-159444126 AAAGTTTTAGAATTGGATAAAGG No data
1017986051_1017986053 -4 Left 1017986051 6:159444078-159444100 CCCTGTGGGTACTGGGTCTCTTC No data
Right 1017986053 6:159444097-159444119 CTTCCTCAAAGTTTTAGAATTGG No data
1017986051_1017986056 4 Left 1017986051 6:159444078-159444100 CCCTGTGGGTACTGGGTCTCTTC No data
Right 1017986056 6:159444105-159444127 AAGTTTTAGAATTGGATAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017986051 Original CRISPR GAAGAGACCCAGTACCCACA GGG (reversed) Intergenic
No off target data available for this crispr