ID: 1017989115

View in Genome Browser
Species Human (GRCh38)
Location 6:159470927-159470949
Sequence AGTCCTTGGAGAGCATCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017989115_1017989118 5 Left 1017989115 6:159470927-159470949 CCTGTGGATGCTCTCCAAGGACT No data
Right 1017989118 6:159470955-159470977 TGAATGCCTGCAGCTTTTACAGG No data
1017989115_1017989121 25 Left 1017989115 6:159470927-159470949 CCTGTGGATGCTCTCCAAGGACT No data
Right 1017989121 6:159470975-159470997 AGGTGCAAGGTGCAAGCTGCTGG No data
1017989115_1017989120 12 Left 1017989115 6:159470927-159470949 CCTGTGGATGCTCTCCAAGGACT No data
Right 1017989120 6:159470962-159470984 CTGCAGCTTTTACAGGTGCAAGG No data
1017989115_1017989122 28 Left 1017989115 6:159470927-159470949 CCTGTGGATGCTCTCCAAGGACT No data
Right 1017989122 6:159470978-159471000 TGCAAGGTGCAAGCTGCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017989115 Original CRISPR AGTCCTTGGAGAGCATCCAC AGG (reversed) Intergenic
No off target data available for this crispr