ID: 1017989424

View in Genome Browser
Species Human (GRCh38)
Location 6:159473203-159473225
Sequence ATCCATGAAAAGCCTGGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017989424_1017989430 19 Left 1017989424 6:159473203-159473225 CCATCTCCAGGCTTTTCATGGAT No data
Right 1017989430 6:159473245-159473267 CCCCTCTCCTGGTGCTGCAGTGG No data
1017989424_1017989434 29 Left 1017989424 6:159473203-159473225 CCATCTCCAGGCTTTTCATGGAT No data
Right 1017989434 6:159473255-159473277 GGTGCTGCAGTGGTTGAATGTGG No data
1017989424_1017989426 8 Left 1017989424 6:159473203-159473225 CCATCTCCAGGCTTTTCATGGAT No data
Right 1017989426 6:159473234-159473256 TCCATGACCTGCCCCTCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017989424 Original CRISPR ATCCATGAAAAGCCTGGAGA TGG (reversed) Intergenic