ID: 1017989430

View in Genome Browser
Species Human (GRCh38)
Location 6:159473245-159473267
Sequence CCCCTCTCCTGGTGCTGCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017989419_1017989430 27 Left 1017989419 6:159473195-159473217 CCCCACCTCCATCTCCAGGCTTT No data
Right 1017989430 6:159473245-159473267 CCCCTCTCCTGGTGCTGCAGTGG No data
1017989418_1017989430 30 Left 1017989418 6:159473192-159473214 CCACCCCACCTCCATCTCCAGGC No data
Right 1017989430 6:159473245-159473267 CCCCTCTCCTGGTGCTGCAGTGG No data
1017989424_1017989430 19 Left 1017989424 6:159473203-159473225 CCATCTCCAGGCTTTTCATGGAT No data
Right 1017989430 6:159473245-159473267 CCCCTCTCCTGGTGCTGCAGTGG No data
1017989420_1017989430 26 Left 1017989420 6:159473196-159473218 CCCACCTCCATCTCCAGGCTTTT No data
Right 1017989430 6:159473245-159473267 CCCCTCTCCTGGTGCTGCAGTGG No data
1017989425_1017989430 13 Left 1017989425 6:159473209-159473231 CCAGGCTTTTCATGGATGACTAT No data
Right 1017989430 6:159473245-159473267 CCCCTCTCCTGGTGCTGCAGTGG No data
1017989421_1017989430 25 Left 1017989421 6:159473197-159473219 CCACCTCCATCTCCAGGCTTTTC No data
Right 1017989430 6:159473245-159473267 CCCCTCTCCTGGTGCTGCAGTGG No data
1017989422_1017989430 22 Left 1017989422 6:159473200-159473222 CCTCCATCTCCAGGCTTTTCATG No data
Right 1017989430 6:159473245-159473267 CCCCTCTCCTGGTGCTGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017989430 Original CRISPR CCCCTCTCCTGGTGCTGCAG TGG Intergenic
No off target data available for this crispr