ID: 1017989434

View in Genome Browser
Species Human (GRCh38)
Location 6:159473255-159473277
Sequence GGTGCTGCAGTGGTTGAATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017989424_1017989434 29 Left 1017989424 6:159473203-159473225 CCATCTCCAGGCTTTTCATGGAT No data
Right 1017989434 6:159473255-159473277 GGTGCTGCAGTGGTTGAATGTGG No data
1017989427_1017989434 -3 Left 1017989427 6:159473235-159473257 CCATGACCTGCCCCTCTCCTGGT No data
Right 1017989434 6:159473255-159473277 GGTGCTGCAGTGGTTGAATGTGG No data
1017989425_1017989434 23 Left 1017989425 6:159473209-159473231 CCAGGCTTTTCATGGATGACTAT No data
Right 1017989434 6:159473255-159473277 GGTGCTGCAGTGGTTGAATGTGG No data
1017989428_1017989434 -9 Left 1017989428 6:159473241-159473263 CCTGCCCCTCTCCTGGTGCTGCA No data
Right 1017989434 6:159473255-159473277 GGTGCTGCAGTGGTTGAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017989434 Original CRISPR GGTGCTGCAGTGGTTGAATG TGG Intergenic
No off target data available for this crispr