ID: 1017992230

View in Genome Browser
Species Human (GRCh38)
Location 6:159501065-159501087
Sequence GTGTGAAGTGGGGTGGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017992230_1017992243 28 Left 1017992230 6:159501065-159501087 CCACCCACCACCCCACTTCACAC No data
Right 1017992243 6:159501116-159501138 GTAAAACTAGATGTTTGTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017992230 Original CRISPR GTGTGAAGTGGGGTGGTGGG TGG (reversed) Intergenic
No off target data available for this crispr