ID: 1017992243

View in Genome Browser
Species Human (GRCh38)
Location 6:159501116-159501138
Sequence GTAAAACTAGATGTTTGTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017992241_1017992243 -3 Left 1017992241 6:159501096-159501118 CCAGCCAATAAACAACTTAAGTA No data
Right 1017992243 6:159501116-159501138 GTAAAACTAGATGTTTGTTATGG No data
1017992237_1017992243 3 Left 1017992237 6:159501090-159501112 CCTCCCCCAGCCAATAAACAACT No data
Right 1017992243 6:159501116-159501138 GTAAAACTAGATGTTTGTTATGG No data
1017992233_1017992243 21 Left 1017992233 6:159501072-159501094 CCACCCCACTTCACACTGCCTCC No data
Right 1017992243 6:159501116-159501138 GTAAAACTAGATGTTTGTTATGG No data
1017992234_1017992243 18 Left 1017992234 6:159501075-159501097 CCCCACTTCACACTGCCTCCCCC No data
Right 1017992243 6:159501116-159501138 GTAAAACTAGATGTTTGTTATGG No data
1017992231_1017992243 25 Left 1017992231 6:159501068-159501090 CCCACCACCCCACTTCACACTGC No data
Right 1017992243 6:159501116-159501138 GTAAAACTAGATGTTTGTTATGG No data
1017992230_1017992243 28 Left 1017992230 6:159501065-159501087 CCACCCACCACCCCACTTCACAC No data
Right 1017992243 6:159501116-159501138 GTAAAACTAGATGTTTGTTATGG No data
1017992235_1017992243 17 Left 1017992235 6:159501076-159501098 CCCACTTCACACTGCCTCCCCCA No data
Right 1017992243 6:159501116-159501138 GTAAAACTAGATGTTTGTTATGG No data
1017992236_1017992243 16 Left 1017992236 6:159501077-159501099 CCACTTCACACTGCCTCCCCCAG No data
Right 1017992243 6:159501116-159501138 GTAAAACTAGATGTTTGTTATGG No data
1017992240_1017992243 -2 Left 1017992240 6:159501095-159501117 CCCAGCCAATAAACAACTTAAGT No data
Right 1017992243 6:159501116-159501138 GTAAAACTAGATGTTTGTTATGG No data
1017992242_1017992243 -7 Left 1017992242 6:159501100-159501122 CCAATAAACAACTTAAGTAAAAC No data
Right 1017992243 6:159501116-159501138 GTAAAACTAGATGTTTGTTATGG No data
1017992239_1017992243 -1 Left 1017992239 6:159501094-159501116 CCCCAGCCAATAAACAACTTAAG No data
Right 1017992243 6:159501116-159501138 GTAAAACTAGATGTTTGTTATGG No data
1017992232_1017992243 24 Left 1017992232 6:159501069-159501091 CCACCACCCCACTTCACACTGCC No data
Right 1017992243 6:159501116-159501138 GTAAAACTAGATGTTTGTTATGG No data
1017992238_1017992243 0 Left 1017992238 6:159501093-159501115 CCCCCAGCCAATAAACAACTTAA No data
Right 1017992243 6:159501116-159501138 GTAAAACTAGATGTTTGTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017992243 Original CRISPR GTAAAACTAGATGTTTGTTA TGG Intergenic
No off target data available for this crispr