ID: 1017994238

View in Genome Browser
Species Human (GRCh38)
Location 6:159518302-159518324
Sequence CATTGCAACTAAGAGAACTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017994238_1017994242 18 Left 1017994238 6:159518302-159518324 CCCTAGTTCTCTTAGTTGCAATG No data
Right 1017994242 6:159518343-159518365 ATACTTCTAAGGTTTTGATGTGG No data
1017994238_1017994243 19 Left 1017994238 6:159518302-159518324 CCCTAGTTCTCTTAGTTGCAATG No data
Right 1017994243 6:159518344-159518366 TACTTCTAAGGTTTTGATGTGGG No data
1017994238_1017994241 7 Left 1017994238 6:159518302-159518324 CCCTAGTTCTCTTAGTTGCAATG No data
Right 1017994241 6:159518332-159518354 GTTCATGTGAGATACTTCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017994238 Original CRISPR CATTGCAACTAAGAGAACTA GGG (reversed) Intergenic
No off target data available for this crispr